You are here

Article Text

Article menu

Download PDFPDF

Letters to the editor
Unexpected high frequency of de novo unbalanced translocations in patients with Wolf-Hirschhorn syndrome (WHS)
  1. DAGMAR WIECZOREK*,
  2. MARIO KRAUSE†,
  3. FRANK MAJEWSKI‡,
  4. BEATE ALBRECHT*,
  5. PETER MEINECKE§,
  6. OLAF RIESS†,
  7. GABRIELE GILLESSEN-KAESBACH*
  1. *Institut für Humangenetik, Universitätsklinikum Essen, Germany
  2. †Molekulare Humangenetik, Ruhr-Universität Bochum, Germany
  3. ‡Institut für Humangenetik und Anthropologie, Heinrich-Heine-Universität Düsseldorf, Germany
  4. §Abteilung Medizinische Genetik, Altonaer Kinderkrankenhaus, Hamburg, Germany
  5. Abteilung für Medizinische Genetik, Universität Rostock, Germany
  1. Dr Wieczorek, Institut für Humangenetik, Universitätsklinikum Essen, Hufelandstrasse 55, D-45122 Essen, Germany, dagmar.wieczorek{at}uni-essen.de

https://doi.org/10.1136/jmg.37.10.798

Statistics from Altmetric.com

    Request Permissions

    If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

    Editor—Wolf-Hirschhorn syndrome (WHS), first described independently in 1965 by Wolf et al 1 and Hirschhorn et al,2 is a well defined multiple congenital anomalies/mental retardation syndrome resulting from deletion involving chromosomal band 4p16.3 with a minimal critical region of 165 kb.3

    Different mechanisms are responsible for WHS, including terminal 4p deletions, familial translocations, and de novo complex chromosomal rearrangements such as unbalanced translocations. The frequency of translocations in WHS as a result of parental chromosomal translocations is estimated to be 5 to 13%,4 5 whereas the rate of sporadic translocations in WHS was suggested to be 1.6% (2/120).5 A few isolated cases with de novo translocations5-12 resulting in WHS have been described recently. The trisomic segment, however, often could not be defined owing to the lack of specific cytogenetic techniques.5 6 8 13-15

    Here we report six patients with unbalanced translocations, t(4p;8p) and t(4p;7p), respectively, and discuss their phenotypic abnormalities.

    Since 1996 we have performed clinical, molecular, cytogenetic, and molecular-cytogenetic investigations in a total of 22 patients with clinical signs of Wolf-Hirschhorn syndrome. These patients were all seen by one of the authors. In five of them (22%), the combination of cytogenetic and molecular investigations showed a de novo unbalanced translocation; in a sixth patient the de novo occurrence of the translocation could not be confirmed because no blood sample from the father was available.

    The clinical findings of patients 1-5, who all presented with characteristic features of WHS, are summarised in table 1. Patient 6 (CL220585/87E1624) had some additional findings listed in table1.

    View this table:
    Table 1

    Clinical findings in patients 1-5 with t(4;8) and patient 6 with t(4;7)

    The combination of Hirschsprung disease and hydrocephalus was suggestive of CRASH syndrome in patient 6, but SSCP analysis of theL1CAM gene was normal.

    Chromosome studies including GTG banding were performed on peripheral blood lymphocytes according to slightly modified standard techniques.16

    DNA from cosmids pC847.351,17 L21f12 (D4S180), and L228a7 (D4S81)18 and inter-Alu PCR products19from YAC 877G6, 405D10, 794D12, 225D2, and 435A11 (CEPH) were labelled with digoxigenin using a BRL nick translation kit (Gibco, Life Technologies Inc, Gaithersburg, MD, USA). Labelled cosmid and YAC DNA was separated from unincorporated nucleotides by using 1800 ml Centricon 30 (Amicon Inc, Beverly, MA 01915, USA) filters. FISH was performed as described by Lichter et al.20 Labelled cosmid DNA (50 ng) or YAC DNA (100 ng) was mixed with human Cot-1 fraction DNA to suppress repetitive sequences or block non-specific hybridisation. Hybridisation was detected using monoclonal anti-digoxin, anti-mouse IgG FITC conjugate and anti-rabbit IgG FITC conjugate (Sigma Immuno Chemicals, St Louis, USA) and counterstained using propidium iodide or DAPI.

    A cosmid derived from D4S96, the 8p telomere probe and 7p distal probe (Oncor, Gaithersburg, VA, USA) and the whole chromosome paints 4 and 8 (AGS, Heidelberg, Germany/Oncor, Gaithersburg, VA, USA) were hybridised according to the manufacturer's instructions. For the hybridisations, clone pGXba11/34021 was used as centromeric control for human chromosome 4.

    Genomic DNA was prepared from peripheral blood lymphocytes or EBV transformed lymphoblastoid cell lines from patients and their parents according to previously described techniques.22 23

    Genotyping of chromosome 4p was performed using the following previously described microsatellite markers: D4S1182 (Acc ID GDB 19723924), D4S43 (Acc ID GDB 12436024), ADRA2C (Acc ID GDB 37083425), HOX7 (Acc ID GDB 15699126 27), D4S403 (Acc ID GDB 18810628), D4S2366 (Acc ID GDB 684453), D4S2639 (Acc ID GDB 685881), and D4S2397 (Acc ID GDB 683982). A new microsatellite, 75B9Rep, was generated by one of the authors based on sequence information of cosmid 75B9A (Acc No Z69651) which is derived from the distal end of the Huntington's disease cosmid contig.29 Oligomers were designed from sequences flanking the compound dinucleotide repeat (CT)2G(CT)26(CA)14. The following primer sequences were used for the amplification of the repeat, forward primer 5′ CTGAACTTTATCCAATTAGTCTTG 3′ and reverse primer 5′ GAATCTTTCTGTCCCACGAT 3′. This primer set amplifies a 227 bp DNA fragment product. PCR reactions were performed in 10 μl volumes containing 100 ng DNA, 0.5 U GenecraftR Taq polymerase, 1 × GenecraftRPCR buffer, 2 μmol/l dNTP, 4 pmol/l of each primer, 1 μCi32P-dCTP (3000 Ci/mmol/lol, Amersham), and 2 mmol/l MgCl2. Formamide (2%) was added to increase stringency of the reaction. After an initial denaturation of one minute, 30 cycles of one minute at 94°C, 30 seconds at 57°C, and 30 seconds at 72°C were carried out in a Crocodile IIIR (Appligene) thermocycler. The PCR products were resolved on 6% polyacrylamide gels flanked by a sequence ladder (M13, −40) as size marker. The Hu4/Hu5 (Acc ID GDB 249651) primer pair amplifies the CAG repeat of the huntingtin gene. Primer Hu4 has been published by Riesset al 25 (primer sequence: Hu4 5′ ATGGCGACCCTGGAAAAGCTGATGAA 3′), and primer Hu5 has been published by Rubinsztein et al 30 (primer sequence: Hu5 5′ GGCGGTGGCGGCTGTTGCTGCTGCTGC 3′).

    At the beginning of our study of 22 WHS patients, we reanalysed the chromosomes in lymphocytes by standard Giemsa banding techniques. At a banding resolution of at least 450 bands per haploid genome,31 an additional small G positive band was observed on the distal short arm of one chromosome 4 in patients 1 and 2 (fig1A) and an unbalanced translocation was suspected in patients 3, 4, and 5 (fig 1B). In patient 6, a deletion of 4p with breakpoints in 4p16.2 was suggested. Thus, we suspected an unbalanced translocation between the short arm of one of the chromosomes 4 and another unidentified chromosome in patients 1-5, while the cytogenetic aberration in patient 6 appeared to be a simple deletion.

    Figure 1
    Figure 1

    (A) Chromosomes 4 of patient 2 showing an additional G positive band in 4pter. (B) Chromosomes 4 of patient 4 showing same length of 4p but different G banded pattern.

    Chromosomal analysis in all participating parents showed a normal karyotype. In patient 5 the father was not available. The remaining 16 patients of this study are described elsewhere (D Wieczorek, manuscript in preparation).

    Different cosmids were used to confirm the clinical diagnosis of WHS in all patients. In patients 1, 2, and 5, a deletion of D4S96 (Oncor) and of cosmids pC847.351 and L228a7 on one homologue of chromosome 4 was noted (fig 2A). In patients 3 and 4, YAC 405D10 was also deleted on one homologue. In patient 5, the size of the deletion was determined by FISH only. Cosmids pC847.351, L21f12, and L228a7 and YACs 877G6 and 405D10 were deleted on one chromosome 4, whereas YACs 794D12, 225D2, and 435A11 were present on both chromosomes 4 (table2).

    Figure 2
    Figure 2

    FISH results in patient 4. (A) FISH with cosmid pC847.351 showing lack of signal in one chromosome 4p. (B) FISH with wcp(4) showing fluorescent signals on the entire length of both chromosomes 4 except for the terminal region of one chromosome 4. (C) FISH with distal 8p probe showing two signals in the distal region of 8p and an additional signal in the distal short arm of one chromosome 4.

    View this table:
    Table 2

    Extent and origin of the 4p deletion in patients 1–6

    FISH staining with a whole chromosome 4 paint (AGS/Oncor) in all six patients gave hybridisation signals along the entire length of both chromosomes 4 except for the distal part of the aberrant chromosome 4p (fig 2B). Both chromosomes 8 showed hybridisation signals along the entire length with whole chromosome paint 8 (AGS), but also on one chromosome 4 in patients 1-5. FISH with an 8p telomere probe (Oncor, Gaithersburg, VA, USA) showed signals on both chromosomes 8 and an additional signal on one chromosome 4 (fig 2C).

    Based on these findings we determined the karyotype of patients 1 and 2 as 46,XX,der(4),t(4;8)(p16.3;p23.1).ish t(4;8)(wcp4−, wcp8+, 8ptel+, pC847.351−, D4S96−, 228a7−; wcp4−, wcp8+, 8ptel+) and in patients 3, 4, and 5 as 46,XX,der(4),t(4;8)(p16.2;p21).ish t(4;8)(wcp4−, wcp8+, 8ptel+, pC847.351−, D4S96−, 228a7−, 405D10−; wcp4−, wcp8+, 8ptel+).

    FISH was also performed in the parents of patients 1-4 and the mother of patient 5. Normal results were detected with D4S96 (Oncor) and with the 8p telomere probe (Oncor). We conclude that the translocation t(4;8) occurred de novo in all patients. However, in patient 4 one could not exclude that the translocation may be inherited from the father.

    To identify the chromosome involved in the translocation of patient 6, we used different paints and telomeric probes of G negative bands. Additional signals on chromosome 4 were noted with distal 7p probe (Oncor) (fig 3). We determined the karyotype in patient 6 as 46,XY,der(4),t(4;7)(p16;p22).ish t(4;8)(wcp4−, 7ptel+, pC847.351−, D4S96−, 228a7−; wcp4−, 7ptel+). Balanced translocations in his parents were excluded with FISH using D4S96 and 7ptel in combination with pGXba11/340.

    Figure 3
    Figure 3

    FISH results in patient 6. FISH with distal 7p probe showing two signals in the distal region of 7p and an additional signal in the distal short arm of one chromosome 4.

    The results of the analyses of polymorphic markers are listed in table2. Blood samples from the father of patient 5 were not available. Therefore, the size of the deletion was determined by FISH only. DNA from patient 4 was not available to identify the origin of the deletion.

    In patients 1, 2, 3, and 6, the maternal allele was absent and in patients 4 and 5 the origin of the deletion remains undetermined. In patients 1, 2, and 6, the deletion 4p was at least 3.8 Mb in size and in patients 3-5 the size of the deletion can be estimated to be 13 Mb.

    In our study of 22 patients with Wolf-Hirschhorn syndrome, a de novo translocation was present in 5/22 (22.7%) and a familial translocation in 3/22 patients (13.6%) (manuscript in preparation). In one additional patient (patient 5) a de novo translocation was suspected, but could not be confirmed. To our knowledge, such a high rate of proven de novo translocations in WHS has not previously been reported. This could be explained by the refined molecular-cytogenetic techniques such as FISH analysis and microsatellite analysis used here. In particular, de novo unbalanced translocations between the short arms of chromosomes 4 and 8 seem to be not uncommon in WHS. Müller-Naviaet al 10 described one fetus and Petit et al 11 12 another male patient with this chromosomal aberration.

    The breakpoints of 4p and 8p differ in our patients, which makes sequence homologies between these chromosomal segments less likely. Thus, it is of great interest that Kogi et al 32 and Gondoet al 33 described a new class of tandemly repeated satellite DNA elements on chromosome 4p and 8p. They identified a tandem array of several RS447 sequence copies in 4p15 and distal 8p. This repeat was suggested to be responsible for formation of inversion duplication 8p34 and might probably explain the higher frequency of translocations between 4p and 8p.

    Moreover, other chromosomes also, for example chromosome 7 in patient 6, occur in de novo unbalanced translocations involving the short arm of chromosome 4. Our findings support the hypothesis of Reidet al 35 that cryptic complex chromosomal rearrangements are more common than usually disclosed by light microscopy of conventionally stained chromosomes. Selection bias was unlikely, as we investigated blood specimens of all children with known WHS and with a tentative diagnosis of WHS.

    Determination of the origin of the deletion showed that in all four patients in whom this was possible the maternal allele was absent, which is in contrast to published data. To avoid bias owing to familial translocations, which are mostly inherited maternally in a 2:1 ratio,36 the patients' parents were also investigated by conventional karyotyping and FISH analysis. We reviewed cases in which the origin of the 4p deletion was determined and found 27 paternally inherited and six maternally inherited deletions.7 15 37-45 Thus, 82% of reported patients with WHS show a paternally derived deletion.

    As to the published patients with maternally inherited deletions, the patient Val described by Anvret et al 39 had a more complex chromosomal rearrangement causing WHS. Further cytogenetic investigations were not possible. Patients 3 and 6 from the report of Dallapiccola et al 44 and case 2 of Thies et al 42 presented with a de novo, maternally inherited deletion with breakpoints in 4p16.1, 4p16.3, or 4p13, respectively. However, FISH analysis with whole chromosome 4 paint was not performed to exclude a cryptic translocation. In the patient described by Greenberg et al,38 cryptic translocation in the mother was discussed, but not investigated. Patient 3 in the report of Kant et al 37 with maternal origin of the deletion had an unbalanced karyotype based on a cryptic translocation t(4;8) in the mother. Thies et al 42 described a third patient with de novo deletion and also a maternally inherited deletion. On the other hand, in two WHS patients with unidentified de novo translocations40 the deletion was of paternal origin.

    Different explanations for the preponderance of paternally inherited deletions are possible, for example, statistical deviation or real biological phenomena such as increased mutation rates in sperm or genomic imprinting.41 An excess of rearrangements in male meiosis, related to differences between the mechanisms of sperm and egg production, have also been discussed.44

    One aim of our study was to determine whether the WHS phenotype is influenced by the trisomic autosomal segment. The clinical findings in our patients 1-5, in previously published patients with familial translocations t(4;8),37 46-52 in patients with partial trisomy 8 owing to inversion duplication53-59 or direct duplication,60 61 respectively, and in patients with WHS6 62 are compared in table 3. There are several clinical signs which are usually present in patients with partial monosomy 4p as well as in those with partial trisomy 8p, such as mental retardation, muscular hypotonia, prominent forehead, broad nasal bridge, large mouth, dysplastic ears, and congenital heart defects. Thus, these features are by no means specific enough to distinguish between the phenotypes.

    View this table:
    Table 3

    Clinical signs of patients with duplication 8p, with unbalanced translocation t(4p;8p), with monosomy 4p, with trisomy 7p, and reported patients

    The face in WHS is much more characteristic than in partial trisomy 8p and is not significantly influenced by the presence of this trisomic segment. All in all, it seems to us impossible to differentiate clinically between patients with WHS resulting from monosomy 4p and WHS resulting from unbalanced translocation 4p;8p. This agrees with the conclusions of other authors.37 47-51

    As to patient 6, to our knowledge, no other patient with a de novo translocation t(4p;7p) has been described before.63 64However, many patients with trisomy 7p resulting from familial translocations have been reported. These patients are not listed in table 3 because a considerable influence on the phenotype by monosomic autosomal segments cannot be excluded. Only those patients with distal duplication 7p are included.65-67 The characteristic, clinically recognisable phenotype in trisomy 7p encompasses delayed closure of fontanelles, sparse or even lack of eyebrows, a short nose with a low and broad nasal bridge, small upper and prominent, full lower lip, micrognathia, hypotonia, congenital heart defect, and delayed speech development.65 Macrocephaly and enlarged cerebral ventricles were only described in one patient.66One might speculate that relative macrocephaly in patient 6, which is highly unusual in patients with WHS, may be the result of the duplicated segment in 7p. Delicado et al 66 noted intestinal malrotation with dilatation of the sigmoid and left colon in their patient, but excluded Hirschsprung's disease. Our patient presented with similar anomalies of the intestines. We assume that this clinical sign, which has not been described in WHS before, may be caused by the duplication 7p. In conclusion, the overall phenotype in patient 6, in contrast to patients 1-5, appears to be considerably influenced by the trisomic region of 7p (table 3).

    In summary, we show that de novo translocations causing WHS are more frequent than previously estimated. We recommend performing FISH analysis with wcp(4) in every WHS patient to exclude or confirm a de novo translocation as a common mechanism causing WHS. Also patients with cytogenetically visible deletions should be investigated by molecular-cytogenetic techniques to exclude cryptic rearrangements. Moreover, de novo translocations t(4p;8p) in WHS patients are more frequent than previously suspected.

    Note added in proof

    Since submission of the final version of this paper, 13 patients of this study have been published elsewhere.

    Acknowledgments

    We thank Professor Passarge for continous support and for reading the manuscript, and Professor Horsthemke for helpful discussion. In addition, we thank Barbara Henke, Barbara Ulrich, Elke Jürgens, and Gudrun Rodepeter for excellent technical assistance and the parents for taking part in this study. We thank Dr Herdit Schüler for the results of previous chromosomal analysis in patient 1, Dr A J H Hamers for performing FISH with D4S10 in patient 2, Dr J J M Engelen for FISH in patient 4, and Dr Schröder and Professor A Gal for SSCP analysis of the L1CAM gene in patient 6. We also thank Tracy Wright for the cosmids pC847.351, 33c6, 21f12, and 228a7. In addition, we thank CEPH for providing the YACs. DW and GG-K were supported in part by a young investigators grant from the Medical Faculty University of Essen (IFORES 107 402.0) and by the Deutsche Forschungsgemeinschaft (Wi1440/4-1).

    References

    1. ↵
      1. Wolf U,
      2. Reinwein H,
      3. Porsch R,
      4. Schröter R,
      5. Baitsch H
      (1965) Defizienz an den kurzen Armen eines Chromosoms Nr 4. Humangenetik 1:397–413.
      OpenUrlPubMedWeb of Science
    2. ↵
      1. Hirschhorn K,
      2. Cooper HL,
      3. Firschein IL
      (1965) Deletion of short arms of chromosome 4-5 in a child with defects of midline fusion. Humangenetik 1:479–482.
      OpenUrlPubMedWeb of Science
    3. ↵
      1. Wright TJ,
      2. Ricke DO,
      3. Denison K,
      4. Abmayr S,
      5. Cotter PD,
      6. Hirschhorn K,
      7. Keinänen M,
      8. McDonald-McGinn D,
      9. Somer M,
      10. Spinner N,
      11. Yang-Feng T,
      12. Zackai E,
      13. Altherr MR
      (1997) A transcript map of the newly defined 165 kb Wolf-Hirschhorn syndrome critical region. Hum Mol Genet 6:317–324.
      OpenUrlAbstract/FREE Full Text
    4. ↵
      1. Centerwall WR,
      2. Thompson WP,
      3. Irving EA,
      4. Fobes CD
      (1975) Translocation 4p- syndrome. Am J Dis Child 129:366–370.
      OpenUrlCrossRefPubMed
    5. ↵
      1. Lurie IW,
      2. Lazjuk GI,
      3. Ussova YI,
      4. Presman EB,
      5. Gurevich DB
      (1980) The Wolf-Hirschhorn syndrome. I. Genetics. Clin Genet 17:375–384.
      OpenUrlPubMedWeb of Science
    6. ↵
      1. Wilson MG,
      2. Towner JW,
      3. Coffin GS,
      4. Ebbin AJ,
      5. Siris E,
      6. Brager P
      (1981) Genetic and clinical studies in 13 patients with the Wolf-Hirschhorn syndrome [del(4p)]. Hum Genet 59:297–307.
      OpenUrlCrossRefPubMedWeb of Science
    7. ↵
      1. Gusella JF,
      2. Tanzi RE,
      3. Bader PI,
      4. Phelan MC,
      5. Stevenson R,
      6. Hayden MR,
      7. Hofman KJ,
      8. Faryniarz AG,
      9. Gibbons K
      (1985) Deletion of Huntington's disease-linked G8 (D4S10) locus in Wolf-Hirschhorn syndrome. Nature 7:75–78.
    8. ↵
      1. Cannizzaro LA,
      2. Hecht BK,
      3. Bixeman HA,
      4. Pazdziorko S,
      5. Tamis R,
      6. Hecht F
      (1988) Prenatal diagnosis of a de novo unbalanced translocation (4p+) following in vitro fertilization. Prenat Diagn 8:297–301.
      OpenUrlPubMed
    9. ↵
      1. Gandelmann KY,
      2. Gibson L,
      3. Meyn MS,
      4. Yang-Feng TL
      (1992) Molecular definition of the smallest region of deletion overlap in the Wolf-Hirschhorn syndrome. Am J Hum Genet 51:571–578.
      OpenUrlPubMedWeb of Science
    10. ↵
      1. Müller-Navia J,
      2. Nebel A,
      3. Oehler D,
      4. Theile U,
      5. Zabel B,
      6. Schleiermacher E
      (1996) Microdissection and DOP-PCR-based reverse chromosome painting as a fast and reliable strategy in the analysis of various structural chromosome abnormalities. Prenat Diagn 16:915–922.
      OpenUrlCrossRefPubMedWeb of Science
    11. ↵
      1. Petit P,
      2. Schmit J,
      3. van den Berghe H,
      4. Fryns JP
      (1996) On two patients with and without the classical Wolf-Hirschhorn syndrome (WHS) sharing the same chromosome 4p16.3 specific probe deletion: evidence of a contiguous gene deletion syndrome. Clin Genet 50:19–22.
      OpenUrlPubMed
    12. ↵
      1. Petit P,
      2. Vermeersch JR,
      3. Fryns JP
      (1998) Identification of a de novo 46,XY, 4p+ with incomplete Wolf-Hirschhorn syndrome as 46,XY, der(4)t(4;8). Genet Couns 9:157–158.
      OpenUrlPubMed
    13. ↵
      1. Rivas F,
      2. Hernandez A,
      3. Nazara Z,
      4. Fragoso R,
      5. Olivares N,
      6. Rolon A,
      7. Cantu JM
      (1979) On the deletion 4p16 Wolf-Hirschhorn syndrome. Ann Genet 22:228–231.
      OpenUrlPubMed
    14. ↵
      1. Ivanov VI,
      2. Levina LY,
      3. Konstantinova LM,
      4. Zayarny AN,
      5. Kuleshov NP,
      6. Kaurov BA
      (1990) Phenotype and crucial chromosomal segments in partial aneuploids of chromosomal segments in partial aneuploids of chromosome 4 in man. Genetika 26:912–924.
      OpenUrlPubMed
    15. ↵
      1. Estabrooks LL,
      2. Lamb AN,
      3. Aylsworth AS,
      4. Callanan P,
      5. Rao KW
      (1994) Molecular characterisation of chromosome 4p deletions resulting in Wolf-Hirschhorn syndrome. J Med Genet 31:103–107.
      OpenUrlAbstract/FREE Full Text
    16. ↵
      1. Seabright M
      (1971) A rapid banding technique for human chromosomes. Lancet 2:971–972.
      OpenUrlPubMedWeb of Science
    17. ↵
      1. Altherr MR,
      2. Smith B,
      3. MacDonald ME,
      4. Wasmuth JJ
      (1989) Isolation of a novel mildly repetitive DNA sequence that is predominantly located at the terminus of the short arm of chromosome 4 near the Huntington disease gene. Genomics 5:581–588.
      OpenUrlCrossRefPubMedWeb of Science
    18. ↵
      1. Riess O,
      2. Siedlaczck I,
      3. Kredtke S,
      4. Melmer G,
      5. Epplen JT,
      6. Deaven LL
      (1994) Characterization of a human chromosome 4 flow-sorted cosmid library. Cytogenet Cell Genet 65:238–242.
      OpenUrlPubMedWeb of Science
    19. ↵
      1. Lengauer C,
      2. Green ED,
      3. Cremer T
      (1992) Fluorescence in situ hybridization of YAC clones after Alu-PCR amplification. Genomics 13:826–828.
      OpenUrlCrossRefPubMedWeb of Science
    20. ↵
      1. Lichter P,
      2. Chang CJ,
      3. Call K,
      4. Hermanson G,
      5. Evans GA,
      6. Housman D,
      7. Ward DC
      (1990) High resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247:64–67.
      OpenUrlAbstract/FREE Full Text
    21. ↵
      1. Hulsebos T,
      2. Schonk D,
      3. Schepens J,
      4. Coerwinkel-Driessen M,
      5. van Dalen I,
      6. Ropers HH,
      7. Wieringa B
      (1987) Isolation and characterization of repetitive alphoid sequences specific for the centromeres of chromosomes 4 and 19. Cytogenetic Cell Genet 46:632.
      OpenUrl
    22. ↵
      1. Neitzel H
      (1986) A routine method for the establishment of permanent growing lymphoblastoid cell lines. Hum Genet 73:320–326.
      OpenUrlCrossRefPubMedWeb of Science
    23. ↵
      1. Miller SA,
      2. Dykes DD,
      3. Polesky HF
      (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 6:1215.
      OpenUrl
    24. ↵
      1. Goold RD,
      2. diSibio GL,
      3. Xu H,
      4. Lang DB,
      5. Dadgar J,
      6. Magrane GG,
      7. Duaiczyk A,
      8. Smith KA,
      9. Cox DR,
      10. Masters SB,
      11. Myers RM
      (1993) The development of sequence-tagged sites for human chromosome 4. Hum Mol Genet 2:1271–1288.
      OpenUrlAbstract/FREE Full Text
    25. ↵
      1. Riess O,
      2. Thies U,
      3. Siedlaczck I,
      4. Potisek S,
      5. Graham R,
      6. Theilmann J,
      7. Grimm T,
      8. Epplen JT,
      9. Hayden MR
      (1994) Precise mapping of the brain 2-adrenergic receptor gene within chromosome 4p16. Genomics 19:298–302.
      OpenUrlCrossRefPubMed
    26. ↵
      1. Padanilam BJ,
      2. Stadler HS,
      3. Mills KA,
      4. Mc Leod LB,
      5. Solursh M,
      6. Lee B,
      7. Ramirez F,
      8. Buetow KH,
      9. Murray JC
      (1992) Characterization of the human HOX 7 cDNA and identification of polymorphic markers. Hum Mol Genet 1:407–410.
      OpenUrlAbstract/FREE Full Text
    27. ↵
      1. Cooperative Human Linkage Centre (CHLC)
      (1994) A comprehensive genetic linkage map with centimorgan density. Science 265:2049–2054.
      OpenUrlAbstract/FREE Full Text
    28. ↵
      1. Gyapay G,
      2. Morissette J,
      3. Vignal A,
      4. Dib C,
      5. Fizames C,
      6. Millasseau P,
      7. Marc S,
      8. Bernardi G,
      9. Lathrop M,
      10. Weissenbach J
      (1994) The 1993-94 Genethon human genetic linkage map. Nat Genet 7:246–339.
      OpenUrlCrossRefPubMedWeb of Science
    29. ↵
      1. Baxendale S,
      2. MacDonald ME,
      3. Mott R,
      4. Francis F,
      5. Lin C,
      6. Kirby SF,
      7. James M,
      8. Zehetner G,
      9. Hummerich H,
      10. Valdes J,
      11. Collins FS,
      12. Deaven LJ,
      13. Gusella JF,
      14. Lehrach H,
      15. Bates GP
      (1993) A cosmid contig and high resolution restriction map of the 2 megabase region containing the Huntington's disease gene. Nat Genet 4:181–186.
      OpenUrlCrossRefPubMedWeb of Science
    30. ↵
      1. Rubinsztein DC,
      2. Barton DE,
      3. Davison BC,
      4. Ferguson-Smith MA
      (1993) Analysis of the huntingtin gene reveals a trinucleotide-length polymorphism in the region of the gene that contains two CCG-rich stretches and a correlation between decreased age of onset of Huntington's disease and CAG repeat number. Hum Mol Genet 2:1713–1715.
      OpenUrlFREE Full Text
    31. ↵
      1. Mitelman F
      , ed (1995) ISCN 1995. An international system for human cytogenetic nomenclature. (S Karger, Basel).
    32. ↵
      1. Kogi M,
      2. Fukushige S,
      3. Lefevre C,
      4. Hadano S,
      5. Ikeda JE
      (1997) Novel tandem repeat sequence located on human chromosome 4p: isolation and characterization. Genomics 42:278–283.
      OpenUrlCrossRefPubMedWeb of Science
    33. ↵
      1. Gondo Y,
      2. Okada T,
      3. Matsuyama N,
      4. Saitoh Y,
      5. Yanagisawa Y,
      6. Ikeda JE
      (1998) Human megasatellite DNA RS447: copy-number polymorphisms and interspecies conservation. Genomics 54:39–49.
      OpenUrlCrossRefPubMedWeb of Science
    34. ↵
      1. Nelson TN,
      2. Dill FJ,
      3. Wood S
      (1998) A megasatellite repeat may be involved in the formation of inversion duplication 8p. Am J Hum Genet Suppl 63:A212.
      OpenUrl
    35. ↵
      1. Reid E,
      2. Morrison N,
      3. Barron L,
      4. Boyd E,
      5. Cooke A,
      6. Fielding D,
      7. Tolmie JL
      (1996) Familial Wolf-Hirschhorn syndrome resulting from a cryptic translocation: a clinical and molecular study. J Med Genet 33:197–202.
      OpenUrlAbstract/FREE Full Text
    36. ↵
      1. Nahara K,
      2. Himoto Y,
      3. Yokoyama Y,
      4. Kasai R,
      5. Hata A,
      6. Kikkawa K,
      7. Takahashi Y,
      8. Wkita Y,
      9. Kimura S,
      10. Kimoto H
      (1984) The critical monosomic segment in 4p- syndrome: a high-resolution banding study on five inherited cases. Jpn J Hum Genet 29:403–413.
      OpenUrlCrossRef
    37. ↵
      1. Kant SG,
      2. Van Haeringen A,
      3. Bakker E,
      4. Stec I,
      5. Donnai D,
      6. Mollevanger P,
      7. Beverstock GC,
      8. Lindeman-Kusse MC,
      9. Van Ommen GJB
      (1997) Pitt-Rogers-Danks syndrome and Wolf-Hirschhorn syndrome are caused by a deletion in the same region on chromosome 4p16.3. J Med Genet 34:569–572.
      OpenUrlAbstract/FREE Full Text
    38. ↵
      1. Greenberg F,
      2. Elder FFB,
      3. Ledbetter DH,
      4. Altherr M,
      5. Wasmuth JJ
      (1989) Molecular confirmation of Wolf-Hirschhorn syndrome with apparently normal chromosomes. Pediatr Res 25 (suppl) 76A.
      OpenUrl
    39. ↵
      1. Anvret M,
      2. Nordenskjöld M,
      3. Stolpe L,
      4. Johansson L,
      5. Bröndum-Nielsen K
      (1991) Molecular analysis of 4p deletion associated with Wolf-Hirschhorn syndrome moving the “critical segment” towards the telomere. Hum Genet 86:481–483.
      OpenUrlPubMed
    40. ↵
      1. Quarrell OWJ,
      2. Snell RG,
      3. Curtis MA,
      4. Roberts SH,
      5. Harper PS,
      6. Shaw DJ
      (1991) Paternal origin of the chromosomal deletion resulting in Wolf-Hirschhorn syndrome. J Med Genet 28:256–259.
      OpenUrlAbstract/FREE Full Text
    41. ↵
      1. Altherr MR,
      2. Gusella JF,
      3. Wasmuth JJ,
      4. Kummer MA,
      5. McKercher SW,
      6. Johnson VP
      (1992) Molecular detection of a 4p deletion using PCR-based polymorphisms; a technique for the rapid detection of the Wolf-Hirschhorn syndrome. Am J Med Genet 44:449–454.
      OpenUrlCrossRefPubMed
    42. ↵
      1. Thies U,
      2. Back E,
      3. Wolff G,
      4. Schroeder-Kurth T,
      5. Hager H-D,
      6. Schröder K
      (1992) Clinical, cytogenetic and molecular investigations in three patients with Wolf-Hirschhorn syndrome. Clin Genet 42:201–205.
      OpenUrlPubMed
    43. ↵
      1. Tupler R,
      2. Bortotto L,
      3. Bühler EM,
      4. Alkan M,
      5. Malik NJ,
      6. Bösch-Al Jadooa N,
      7. Memo L,
      8. Maraschio P
      (1992) Paternal origin of the de novo deleted chromosome 4 in Wolf-Hirschhorn syndrome. J Med Genet 29:53–55.
      OpenUrlAbstract/FREE Full Text
    44. ↵
      1. Dallapiccola B,
      2. Mandich P,
      3. Bellone E,
      4. Selicorni A,
      5. Mokin V,
      6. Ajmar F,
      7. Novelli G
      (1993) Parental origin of chromosome 4p deletion in Wolf-Hirschhorn syndrome. Am J Med Genet 47:921–924.
      OpenUrlCrossRefPubMedWeb of Science
    45. ↵
      1. Dean JCS,
      2. Davidson M,
      3. Kelly K,
      4. Stephen GS
      (1993) Wolf-Hirschhorn syndrome: paternal origin of a submicroscopic deletion of chromosome 4. J Med Genet 30:348.
      OpenUrl
    46. ↵
      1. Oorthuys JWE,
      2. Bleeker-Wagemakers EM
      (1989) A girl with the Pitt-Rogers-Danks syndrome: further delineation. Am J Med Genet 55:420–422.
      OpenUrlCrossRef
    47. ↵
      1. Tranebjaerg L,
      2. Petersen A,
      3. Hove K,
      4. Rehder H,
      5. Mikkelsen M
      (1984) Clinical and cytogenetic studies in a large (4;8) translocation family with pre- and postnatal Wolf syndrome. Ann Genet 27:224–229.
      OpenUrlPubMedWeb of Science
    48. ↵
      1. Stengel-Rutkowski S,
      2. Warkotsch A,
      3. Schimanek P,
      4. Stene J
      (1984) Familial Wolf's syndrome with a hidden 4p deletion by translocation of an 8p segment. Unbalanced inheritance from a maternal translocation (4;8)(p15.3;p22). Case report, review and risk estimates. Clin Genet 25:500–521.
      OpenUrlPubMedWeb of Science
    49. ↵
      1. Martsolf JT,
      2. Chase TR,
      3. Jalal SM,
      4. Wasdahl WA
      (1987) Familial transmission of Wolf syndrome resulting from specific deletion 4p16 from t(4;8)(p16;p21)mat. Clin Genet 31:366–369.
      OpenUrlPubMed
    50. ↵
      1. Wheeler PG,
      2. Weaver DD,
      3. Palmer CG
      (1995) Familial translocation resulting in Wolf-Hirschhorn syndrome in two related unbalanced individuals: clinical evaluation of a 39-year-old man with Wolf-Hirschhorn syndrome. Am J Med Genet 55:462–465.
      OpenUrlCrossRefPubMedWeb of Science
    51. ↵
      1. Partington MW,
      2. Fagan K,
      3. Soubjaki V,
      4. Turner G
      (1997) Translocation involving 4p16.3 in three families: deletion causing the Pitt-Rogers-Danks syndrome and duplication resulting in a new overgrowth syndrome. J Med Genet 34:719–728.
      OpenUrlAbstract/FREE Full Text
    52. ↵
      1. Bar-El H,
      2. Ziv M,
      3. Yehudai I,
      4. Borochowitz Z,
      5. Dar H
      (1998) Familial translocation t(4;8)(p15;p23) resulting in Wolf-Hirschhorn syndrome: a recurrent non-random rearrangement? Am J Hum Genet Suppl 63:712.
      OpenUrl
    53. ↵
      1. Fryns JP,
      2. Klezkowsky A,
      3. Dereymaker AM,
      4. Hoefnagels M,
      5. Heremans G,
      6. Marien J,
      7. van den Berghe H
      (1985) Partial trisomy due to interstitial duplication: karyotype: 46,XX,inv dup(8)(p21.1→p22). Clin Genet 28:546–549.
      OpenUrlPubMed
    54. ↵
      1. Dill FJ,
      2. Schertzer M,
      3. Sandercock J,
      4. Tischler B,
      5. Wood S
      (1987) Inverted tandem duplication generates a duplication deficiency of chromosome 8p. Clin Genet 32:109–113.
      OpenUrlPubMed
    55. ↵
      1. Kleczkowska A,
      2. Fryns JP,
      3. D'Hondt F,
      4. Jaeken J,
      5. van den Berghe H
      (1987) Partial duplication 8p due to interstitial duplication: inv dup (8)(p21.1→p22). Ann Genet 30:47–51.
      OpenUrlPubMed
    56. ↵
      1. Nevin NC,
      2. Morrison PJ,
      3. Jones J,
      4. Mac Reid C
      (1990) Inverted tandem duplication of 8p12→p23.1 in a child with increased activity of glutathione reductase. J Med Genet 27:135–136.
      OpenUrlAbstract/FREE Full Text
    57. ↵
      1. Gorinati M,
      2. Caufin D,
      3. Minelli A,
      4. Memo L,
      5. Gaspardo G,
      6. Dodero A
      (1991) Inv dup (8) (p21.1→22.1): further case report and a new hypothesis on the origin of the chromosome abnormality. Clin Genet 39:55–59.
      OpenUrlPubMed
    58. ↵
      1. Feldmann GL,
      2. Weiss L,
      3. Phelan MC,
      4. Schroer RJ,
      5. Van Dyke DL
      (1993) Inverted duplication of 8p: ten new patients and review of the literature. Am J Med Genet 47:482–486.
      OpenUrlCrossRefPubMedWeb of Science
    59. ↵
      1. Engelen JJM,
      2. de Die-Smulders CEM,
      3. Fryns JP,
      4. Hoovers JMN,
      5. Albrechts JCM,
      6. Loots WJG,
      7. Jacobs ME,
      8. Hamers AJH
      (1994) Partial trisomy and monosomy 8p due to inversion duplication. Clin Genet 45:203–207.
      OpenUrlPubMed
    60. ↵
      1. Dhooge C,
      2. Van Roy N,
      3. Crae M,
      4. Speleman F
      (1994) Direct transmission of a tandem duplication in the short arm of chromosome 8. Clin Genet 45:36–39.
      OpenUrlPubMed
    61. ↵
      1. Engelen JJM,
      2. de Die-Smulders CEM,
      3. Sijstermans JMJ,
      4. Meers LEC,
      5. Albrechts JCM,
      6. Hamers AJH
      (1995) Familial partial trisomy 8p without dysmorphic features and only mild mental retardation. J Med Genet 32:792–795.
      OpenUrlAbstract/FREE Full Text
    62. ↵
      1. Estabrooks LL,
      2. Rao KW,
      3. Driscoll DA,
      4. Crandall BF,
      5. Dean JCS,
      6. Ikonen E,
      7. Korf B,
      8. Aylsworth AS
      (1995) Preliminary phenotypic map of chromsome 4p16 based on 4p deletions. Am J Med Genet 57:581–586.
      OpenUrlCrossRefPubMedWeb of Science
    63. ↵
      (1994) Human cytogenetics database. (Oxford University Press, Oxford).
    64. ↵
      1. Borgaonkar DS
      (1994) Chromosomal variation in man. (Wiley-Liss, New York), 7th ed..
    65. ↵
      1. Zerres K,
      2. Schwanitz G,
      3. Gellissen K,
      4. Schroers L,
      5. Sohler R
      (1989) Duplication 7p de novo and literature review. Ann Genet 32:225–229.
      OpenUrlPubMed
    66. ↵
      1. Delicado A,
      2. Escribano E,
      3. Pajares IL,
      4. de Bustamante AD,
      5. Carrasco S
      (1991) A malformed child with a recombinant chromosome 7, rec(7) dup p, derived from a maternal pericentric inversion inv(7)(p15q36). J Med Genet 28:126–127.
      OpenUrlAbstract/FREE Full Text
    67. ↵
      1. Redha MA,
      2. Krishna Murty DS,
      3. Al-Awadi SA,
      4. Al-Sulaiman IS,
      5. Sabry MA,
      6. El-Bahey SA,
      7. Farag TI
      (1996) De novo direct duplication 7p (p11.2→pter) in an arab child with MCA/MR syndrome. Trisomy 7p - a delineated syndrome? Ann Genet 39:5–9.
      OpenUrlPubMed
      1. Wieczorek D,
      2. Krause M,
      3. Majewski F,
      4. Albrecht B,
      5. Horn D,
      6. Riess O,
      7. Gillessen-Kaesbach G
      (2000) Effect of the size of the deletion and clinical manifestation in Wolf-Hirschhorn syndrome: analysis of 13 patients with a de novo deletion. Eur J Hum Genet 8:515–526.
      OpenUrl