Spinocerebellar ataxia (SCA) 16 (MIM: 606364) is an autosomal dominant cerebellar ataxia that was first found in a Japanese family.1 The ages at onset of the affected members ranged from 20–66 years. All showed cerebellar ataxia, and some patients also had head tremor and mental dysfunction. Brain magnetic resonance imaging (MRI) demonstrated cerebellar atrophy without brainstem involvement.1 2 Genome-wide linkage analyses suggested a linkage to 3p26.2-pter,2 which overlaps with the SCA15 locus, 3p24.2-3pter,3 raising a possibility that these phenotypically similar disorders are genetically identical.

SCA15 (MIM: 606658) is a slowly progressing pure cerebellar ataxia that was found in an Australian family.4 Hara et al also described Japanese families with a similar phenotype linked to the region shared with the SCA15 locus.5 Recently, van de Leemput et al reported the deletion of exons 1-10 of the inositol 1,4,5-triphosphate receptor gene (ITPR1, MIM: 147265) and exons 1-3 of the sulfatase-modifying factor 1 gene (SUMF1, MIM: 607939) in the SCA15 patients.6 They also identified the relatively large deletions involving ITPR1 and SUMF1 in two British families with an inherited cerebellar ataxia similar to that of SCA15.6 Here we report the identification of ITPR1 deletion in SCA16 patients who have no SUMF1 deletion.

METHODS

Patients and DNA samples

Clinical studies of patients in a four generation Japanese pedigree with SCA16 and DNA isolation were described previously.1 2 This study was approved by the Ethics Committee of Kyushu University, Faculty of Medicine. All blood samples were obtained with written informed consent.

Real time quantitative PCR

Two DNA samples, obtained from patient IV-2 and his unaffected brother IV-1 (fig 1A), were used for the copy number analysis. Sequences of the primers used in this study are shown in table 1. The polymerase chain reaction (PCR) amplification was performed in a total volume of 20 μl, containing 10 ng of genomic DNA, 1 X Power SYBR Green PCR master mix (Applied Biosystems, Foster City, California, USA), 250 nM of the forward and reverse primers. The real time PCR was performed on the ABI PRISM 7000 Sequence detection system (Applied Biosystems) and amplification was achieved using the standard amplification protocol as follows: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. To normalise the amount of target DNA, the RNase P gene was amplified in a separate reaction well under identical thermal cycling conditions. The reactions were performed in a total volume of 20 μl, containing genomic DNA, 1 X TaqMan Universal PCR master mix (Applied Biosystems), and 1 μl of TaqMan RNase P control reagents (VIC) (Applied Biosystems). Each reaction was run in triplicate.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1 Identification and analysis of ITPR1 deletion in SCA16. (A) Pedigree of the SCA16 family. Filled symbols represent affected individuals; and open symbols unaffected individuals. (B) Analysis of the copy number of SUMF1 and ITPR1 by real time quantitative PCR. Structures of SUMF1 and ITPR1 are shown on top. Exons are shown as black boxes. Arrows indicate the transcription directions of each gene. SUMF1 and ITPR1 are composed of 9 and 58 exons, respectively, and arranged in a head-to-head manner. The length of the intergenic region is about 26 kb. Copy numbers determined by real-time quantitative PCR are schematically shown in the middle. Positions of exons (ex) and intergenic regions (ig) examined are denoted. White circles represent the positions with two copies and black circles represent a single copy in the patient IV-2. The thin and double lines show the deleted and non-deleted regions, respectively. Arrows indicate PCR primers used in panels C and D. A genomic region deleted in SCA16 is shown at the bottom. The telomeric breakpoint was located between ig2 and ig3 and the centromeric breakpoint was located within the intron 48 of ITPR1. (C) DNA sequence of the recombination junction fragment. A DNA fragment encompassing the recombination junction was amplified with a pair of primers Ig21F and 48inR3. The sequence of the resulting fragment was compared with the published human genome sequence and then breakpoints were estimated. The telomeric and centromeric sequences are boxed and the common nucleotides are marked by dots. (D) Deletion specific PCR. Individuals in the SCA16 family examined are indicated. Primer pairs, Ig212F and 48in R25 and 48inF235 and 48in R25, in panel B, were used for detection of the mutant and normal alleles, respectively. A deletion specific PCR product, 547 bp in length, was observed in each affected member, III-13, IV-2 and IV-9, while a product for the normal allele, 366 bp in length, was detected in all members examined.

Isolation and sequence analysis of the junction fragment

Several forward and reverse primers were prepared within the intergenic region and intron 48 of ITPR1, respectively. PCR using genomic DNA of patient IV-2 with a pair of primers, Ig21F (5′-TTTGCTTGTTGCTCATCCAAC) and 48inR3 (5′-CACTAACACGCCAGTGCCTA), gave rise to a product, about 1.2 kb in length. Sequencing was performed using BigDye Terminator v3.1 Sequencing Standard Kit (Applied Biosystems) and the DNA sequence was determined on an automated Applied Biosystems Model 3100 DNA sequencer.

Deletion specific PCR

Genomic DNA (20 ng) was subjected to PCR in a total volume of 20 μl, containing 250 nM each of primers, Ig212F (5′- CAATGCTGCAGGTTGTCAAG) and 48inF235 (5′- GACCCCAGAGGATCACTAACC) and 500 nM of 48inR25 (5′-GTACGTGAGAATGGATCTCG). The PCR products were separated in a 2% agarose gel by electrophoresis and stained with ethidium bromide.

RESULTS

Identification of ITPR1 deletion and mapping the breakpoints by real time quantitative PCR

The pedigree of the SCA16 family is shown in fig 1A. ITPR1 and SUMF1 are located at 3p26.1 in a head-to-head manner and their intergenic region is about 26 kb in length (fig 1B). The sequences of all exons of ITPR1 and SUMF1 of patient II-2 were determined previously and no mutations were detected.2 In the present study we used two DNA samples, obtained from patient IV-2 and his unaffected brother IV-1, for the copy number analysis of these two genes by real time quantitative PCR using SYBR Green dye. We set up primers for appropriate exons of ITPR1 and SUMF1. Sequences of the primers used are shown in table 1 and results are schematically shown in fig 1B. The patient has a single copy of exons 1, 7, 20, 42, and 48 of ITPR1 and two copies of exons 49-52 of ITPR1 and exons 2 and 5 of SUMF1, while his unaffected brother has two copies of all exons examined. We failed amplification of exon 1 of SUMF1 probably because of GC-rich sequences. Real time PCR using additional six pairs of primers within the intergenic region revealed that the telomeric breakpoint was located between the intergenic regions 2 and 3. These data suggest that the patient has a large heterozygous deletion involving exons 1-48 of ITPR1.

Isolation and sequence analysis of the junction fragment

We prepared several forward primers between the intergenic regions 2 and 3 and several reverse primers within the intron 48 of ITPR1 and performed PCR with various combinations of the forward and reverse primers using DNA from patient IV-2 as a template. When we used a pair of primers Ig21F and 48inR3 (fig 1B), a PCR product about 1.2 kb in length was obtained (data not shown). Sequence analysis of the junction fragment comparing to the published human genome sequence (Ensembl release 45; June 2007) revealed the breakpoints of the recombination event and the size of the deletion, 313,318 bp (fig 1C). The telomeric breakpoint was located in the middle of the intergenic region of 26 kb. Therefore, the entire coding and 13 kb upstream regions of SUMF1 are intact.

Deletion specific PCR used as a diagnostic tool

For efficient detection of ITPR1 deletion in the members of this family (fig 1A), we newly designed PCR primers targeting the deletion mutant allele, Ig212F and 48inR25, and the intact normal allele, 48inF235 and 48inR25 (fig 1B). Results of the representative members are shown in fig 1D. A deletion specific PCR fragment of 547 bp in length was observed in all affected individuals examined (II-3, II-4, III-5, III-7, III-10, III-11, III-13, III-15, IV-2 and IV-9), but not in all unaffected individuals examined (III-6, III-8, III-12, III-14, IV-1, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8, and IV-10). The normal allele was also amplified as the 366-bp fragment in all affected individuals, indicating the heterozygous deletion of ITPR1. Deletion of ITPR1 in patients III-13, IV-2 and IV-9 was also confirmed by the copy number analysis of exon 1 of ITPR1 by real time quantitative PCR described above (data not shown).

DISCUSSION

We observed a heterozygous deletion of ITPR1 in the affected members in the SCA16 family, suggesting that haploinsufficiency causes SCA16. This is the first report of cerebellar ataxia caused by ITPR1 deletion without SUMF1 deletion. Van de Leemput et al found heterozygous deletions of both ITPR1 and SUMF1 in the SCA15 and two additional families. They, however, concluded that deletion of ITPR1 underlie the ataxia phenotype,6 because homozygous mutations in SUMF1 leads to multiple sulfate deficiency (MIM: 272200) and heterozygous carriers of SUMF1 mutations do not exhibit a movement disorder.7 They also showed a dramatic decrease in ITPR1 levels of Epstein–Barr virus immortalised leucocytes from affected members of the SCA15 family compared with that from members without the deletion. Our data provide supportive evidence that haploinsufficiency of ITPR1 alone causes SCA15/SCA16.

The breakpoints and size of the deleted segments in these four families are all different. The deletions found in the SCA15 family and two additional families remove exons 1-10, 1-40, and 1-44 of ITPR1, respectively, and all three types of deletions commonly remove exons 1-3 of SUMF1.6 In SCA16 the deletion spans exons 1-48 of ITPR1, leaving SUMF1 intact. Both telomeric and centromeric breakpoints in our case are not located in any repetitive elements but in the AT-rich region. There are no homologous sequences except two nucleotides between the regions around the telomeric and centromeric breakpoints, indicating that the recombination occurred by non-homologous end joining.8

In the previous report we stated IV-6, a 16-year-old boy, as affected because of his rebound nystagmus, although brain MRI demonstrated no cerebellar atrophy.2 In the present report we changed his status to unaffected because he has no ITPR1 deletion (fig 1D) and nystagmus is not observed at present on video-oculography. As we have mentioned in the previous report, given that the status of IV-6 is unknown, SCA16 maps to a 6.4-Mb region on 3p26.1-pter.2 Moreover, given that the status of IV-6 is unaffected, SCA16 maps to a 3.7-Mb region flanked by the markers D3S3630 and D3S1515 on 3p26.1-26.3 (maximum lod score 4.563). This is consistent with the observation that ITPR1 on 3p26.1 is responsible for SCA16. The point mutation found in the 3′-untranslated region of the contactin 4 gene (CNTN4) of all affected members and also unaffected IV-6 in the SCA16 family2 may be a rare polymorphism which is not responsible for the disease.

Pathogenesis of cerebellar ataxia caused by the heterozygous deletion of ITPR1 is unknown. ITPR1 encodes type 1 inositol 1,4,5-triphosphate (IP₃) receptor, an IP₃-gated Ca²⁺ release channel. Itpr1 is highly expressed in the cerebellar Purkinje cells in mice. Homozygous Itpr1 knockout mice display severe ataxia and epilepsy and die early in development.9 It is noteworthy that heterozygous knockout mice grow normally but the impairment of motor coordination is evident when they are tested on a rotating rod at the age of 2 months.10 Further analysis of the heterozygous knockout mice for a long period of life may provide insights into the pathogenesis of SCA15/SCA16.