Biochemical and Biophysical Research Communications
Retinal expression of zebrafish six3.1 and its regulation by Pax6
Section snippets
Materials and methods
Production of RNA. Templates for RNA synthesis were prepared by PCR amplification using cDNA for six3.1 (AF030280) and pax6.1 (X61389). Template for six3.1 antisense probe was amplified using T7 and SX10 (GCGATCAACAAGCATGAATCCATC). The whole pax6.1 cDNA was amplified using T7 and PAX6-SP6 F (CACGAGCAACACGGTTA, underlined part shows an incorporated SP6 sequence). Amplified PCR products were gel-purified and RNAs were produced using T7 (six3.1) or SP6 (pax6.1) RiboMAX Large
Results
Using DNA in situ hybridization probes retinal expression of six3.1 was not detected during later stages of eye development [10]. Since this observation was not consistent with the results reported for other vertebrate species we made further investigations using RNA whole-mount in situ hybridization. By this approach we detected six3.1 transcripts in the differentiating retina from 32 hpf. At this stage a thin layer of six3.1 staining is located in a part of the retinal neuroepithelium (RNE)
Discussion
The early expression pattern of zebrafish six3.1 shows clear similarities to vertebrate orthologues (mouse, human, chicken, Xenopus, and medaka) and the zebrafish paralogues six3.2 and six7[6], [22]. A particularly close relationship has been demonstrated for the two zebrafish genes six3.1 and six3.2 possibly reflecting an extra genome duplication in fish [5]. Although the early expression patterns are similar for these two zebrafish genes, the later retinal expression is quite different.
Acknowledgements
We thank Dr. Thomas Becker for providing zebrafish albino embryos and β-gal antibody and Dr. Øyvind Drivenes and Dr. Ståle Ellingsen for helpful discussions and scientific/technical advice. This work was funded by the Norwegian Research Council and Norwegian Cancer Society.
References (46)
- et al.
Dachshund and eyes absent proteins form a complex and function synergistically to induce ectopic eye development in Drosophila
Cell
(1997) - et al.
Ectopic lens induction in fish in response to the murine homeobox gene Six3
Mech. Dev.
(1996) - et al.
Identification and expression of six family genes in mouse retina
FEBS Lett.
(1996) - et al.
Six class homeobox genes in Drosophila belong to three distinct families and are involved in head development
Mech. Dev.
(1999) - et al.
Transient expression of a novel Six3-related zebrafish gene during gastrulation and eye formation
Gene
(1998) - et al.
Expression of two zebrafish homologues of the murine Six3 gene demarcates the initial eye primordia
Mech. Dev.
(1998) - et al.
Expression pattern of cSix3, a member of the Six/sine oculis family of transcription factors
Mech. Dev.
(1998) - et al.
Genomic cloning, structure, expression pattern, and chromosomal location of the human SIX3 gene
Genomics
(1999) - et al.
Giant eyes in Xenopus laevis by overexpression of XOptx2
Cell
(1999) - et al.
Expanded retina territory by midbrain transformation upon overexpression of Six6 (Optx2) in Xenopus embryos
Mech. Dev.
(2000)
Molecular cloning and embryonic expression of Xenopus Six homeobox genes
Mech. Dev.
Regulation of the human SIX3 gene promoter
Biochem. Biophys. Res. Commun.
Embryonic expression and DNA-binding properties of zebrafish pax-6
Biochem. Biophys. Res. Commun.
Characterisation of the promoter region of the zebrafish six7 gene
Biochim. Biophys. Acta
A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription
Biochem. Biophys. Res. Commun.
Discovery and modeling of transcriptional regulatory regions
Curr. Opin. Biotechnol.
POU domain factor Brn-3b is essential for retinal ganglion cell differentiation and survival but not for initial cell fate specification
Dev. Biol.
Pax6 lights-up the way for eye development
Curr. Opin. Cell Biol.
Eyeless initiates the expression of both sine oculis and eyes absent during Drosophila compound eye development
Development
Six family genes-structure and function as transcription factors and their roles in development
Bioessays
The Optx2 homeobox gene is expressed in early precursors of the eye and activates retina-specific genes
Proc. Natl. Acad. Sci. USA
The Drosophila homeobox gene optix is capable of inducing ectopic eyes by an eyeless-independent mechanism
Development
Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development
Development
Cited by (24)
Cell fate decisions, transcription factors and signaling during early retinal development
2022, Progress in Retinal and Eye ResearchCitation Excerpt :Critical to the understanding of the individual roles of Six3 and Six6 is to identify their key spatiotemporal upstream regulators. Although earlier studies examined human SIX3 (Lengler and Graw, 2001) and zebrafish Six3.1 promoters (Wargelius et al., 2003) and identified their regulation by Pax6 and established autoregulation in zebrafish (Suh et al., 2010), analyses of distal elements as well as expression of nearby Six3os1/SIX3-AS1 remain in their infancy. Most recently, identification of poised enhancers and analysis of topologically associated domains (TADs) including orphan CpG islands indicate intriguing complexity of both Six3 and Six2 gene control during early mouse embryogenesis (Pachano et al., 2021).
A trans-Regulatory code for the forebrain expression of Six3.2 in the Medaka fish
2015, Journal of Biological ChemistryCitation Excerpt :In support of the efficiency of this approach, the majority of the candidates selected after this combined analysis showed expression patterns either overlapping with or complementary to that of Six3.2, which we interpreted as consistent with an activator or repressor role, respectively (Fig. 8, A and B). For Tcf3, Pax6, Pbx1, and Msx2, these predictions were validated by gain and loss of function assays, which, in the case of Pax6, are also supported by earlier studies (20, 46, 47, 61). The direct binding of these TFs to the predicted CREs was further validated with ChIP experiments.
Müller glia: Stem cells for generation and regeneration of retinal neurons in teleost fish
2014, Progress in Retinal and Eye ResearchCitation Excerpt :Six3 can also inhibit nodal/TGFβ signaling during zebrafish gastrulation (Inbal et al., 2007), and when six3b and the TGFβ corepressor tgif1 are both mutated, the retinal regeneration defect is enhanced (Lenkowski et al., 2013). Six3 also demonstrates transcriptional cross-regulation with other key retinal determination factors that likely play a role in regeneration, such as Pax6 (Carl et al., 2002; Loosli et al., 1998; Wargelius et al., 2003). Expression of Pax6 is critical for many aspects of retinal development, from patterning the early eye field, to regulating the cell cycle and retinal neuron differentiation (as reviewed in Shaham et al., 2012).
The transcription factor Six1a plays an essential role in the craniofacial myogenesis of zebrafish
2009, Developmental BiologyCitation Excerpt :Furthermore, in both Six1−/−Six4−/− and Eya1−/−Eya2−/− double mutants, pax3 fails to express in the hypaxial dermomyotome, which then causes cell death and reduces muscle progenitor cells in the limbs (Grifone et al., 2005; Grifone et al., 2007). In zebrafish, six members of the six gene have been defined: six1a, –1b, six2, –2.1, Six3a, –3b, six4.1–4.3, six7 and six9 (Kobayashi et al., 1998, 2000, 2001; Drivenes et al., 2000; Wargelius et al., 2003; Bessarab et al., 2004, 2008). Both six1a and six4.2 are expressed in the presomitic mesoderm, somites and pectoral fin bud.
Zebrafish: A model system for the study of eye genetics
2008, Progress in Retinal and Eye Research
- 1
Present address: Institute of Marine Research, P.O. Box 1870, Bergen N-5024, Norway.