Inherited variants and polymorphisms at 13q locus
| Gene | NCBI SNP Id | Segregating allele frequency | Intron/exon | Major/minor allele |
| SPRY2 | rs504122 | 25.0% | Exon | C/T |
| SPRY2 | rs11911 | 38.0% | 3′UTR | T/G |
| RNF219 | rs35712557 | N/A | Exon | GA/-- |
| LMO7 | rs7997101 | 45.0% | CNC | C/T |
| KLF12 | rs3764134 | 47.0% | Exon | C/A |
| POU4F1 | None* | N/A | Promoter | C/A |
↵* The SNP identified was not listed in dbSNP (http://www.ncbi.nih.gov/SNP/); however, the sequence surrounding the SNP is as follows: GCCGTCCCGGGGAGCT(C/A)TCGCGAGAGCTCGCGGCCCCA at chromosome 13 position 78 075 760 (Human Mar. 2006 (hg18) assembly).
--, a 2 bp deletion; CNC, conserved non-coding; N/A, not available; SNP, single-nucleotide polymorphism; UTR, untranslated region.