Table 1

 Primers for long range amplification across exon 1 and 2 deletions

Forward primersReverse primers
Distance centromeric of exon 1 (kb)Primer sequenceDistance telomeric of exon 2 (kb)Primer sequence
22.5CCTCGTAGGCTGTGGGTTTA2TTTGACGAGAAACAGGTTTACAA
20TCCCAGTCCTGTCTCCAGTC4.5ATCTCTCAAGGGCTGCCAGT
18TAGGCCATCAGTCCTGGTTC7CCCCTTCCCAAACTGTACCT
16.5GCTGTGGGACAAATCTAGGC8.5GGAATTGCTTTAAAAGGCTACA
14.5CCACAGTCCCTTCACTTGGT14.5CAATTGCTAGAAGAGCATTATGG
10.5CCTACCTTTGCCCCAGCTC17.5TCCAAAAAGATACATCAGCAAAGA
8CAGGCCCTGTGATAGAGAGG18.5GAAAAAGGAAGACCAAGTGTGC
6GAGCTGCTTTTCAGCCTTTG20TGAAAAGAGCGAGGGAAGAG
3.5AGGGGAGGAACCAGTGTCTT
1.5CAAAGAGCTGGCCCTTGTAG