Table 1

 Primer sets for MYH gene mutation analysis

ExonPurposeOligonucleotide sequence (5′-3′)
1Sequencecggtgtacaacggaacttgt
gacgtctgaacggaagttcg
2Sequenceccttggaaggcctcaaaat
cctgaatctgcctttcatgg
2DGGEgccgcctgcagcccgcgccccccgtgcccccgccccgcccccggcccgggcgccggtggatgagagggagatagc
gggcggggcgaatgagccttgggccacaac
3-4-5Sequenceatactgccacaggctgct
ctctcatctggggtctga
6-7-8Sequencettggggtgggtgtagagaag
agaggggccaaagagttagc
7DGGEgccgcctgcagcccgcgccccccgtgcccccgccccgcccccggcccgggcgccgagggtaggggaaataggaac
gggcggggcgtataagacacccaagactcc
8DGGEgccgcctgcagcccgcgccccccgtgcccccgccccgcccccggcccgggcgccgggtaaggggatggcaggagg
ggctgggaggaaggaggctg
9-10-11Sequencegtgcccagcctccttcct
agaactggaatggggcttct
10DGGEgccgcctgcagcccgcgccccccgtgcccccgccccgcccccggcccgggcgccgggtgcttcaggggtgtctgc
gggcggggcgcttctcactgccccttcccc
12-13Sequencetctaggttggcccctaaagc
aagggtcaaggggttcaaat
14Sequencecggaatagccaaggatgttg
ttcatgtagaacatgtaggaaacac
15Sequencetgaagttaagggcagaacacc
actgatggctccacaattca
16Sequencegggaaagggagagaggacaa
caaaaataagcactttactaacaacag