Table 2

VEGF genotyping 5′ nuclease (TaqMan) primer and probe sequences

Primer/probeSequence
Positions of polymorphisms are marked in lower case. MGB, minor groove binding probe; TAMRA, fluorescence quencher labelled probe. Forward and reverse sequences are primers; A, C, and G are the probe alleles.
−2578 forward5′TCAGTCCATGCCTCCACAGA3′
−2578 reverse5′GGAACAAAGTTGGGGCTCTGA3′
−2578 A probeVIC-TATCCACCCAGATCtTGCCAGGGTC-TAMRA
−2578 C probeFAM-CCACCCAGATCgTGCCAGGGT-TAMRA
−1154 forward5′CGGGCCAGGCTTCACTG3′
−1154 reverse5′GGCGGGGACAGGCGA3′
−1154 A probeVIC-CTCAGCCCtTCCACA-MGB-NFQ
−1154 G probeFAM-CTCAGCCCcTCCAC-MGB-NFQ
−634 forward5′TCCAGAGAGAAGTCGAGGAAGAGA3′
−634 reverse5′CCCCAAAAGCAGGTCACTCA3′
−634 C probeVIC-TGCCCCTGTCgCTTTCGCTG-TAMRA
−634 G probeFAM-TTGCCCCTGTCcCTTTCGCTG-TAMRA