Table 1

 Primers used for the amplification of the sialin gene (SLC17A5) and cDNA

FragmentPrimers (5′→3′)Nucleotide positionSize (bp)Ta (°C)
Position of primers are numbered according to Genbank database entry NT_007158.10 (gene) and AJ387747.1 (cDNA). Ta, annealing temperature
Genomic DNA
    Exon 1Forward: AGTCCAACCCAAGCCAGAGTT50–7046254
Reverse: AACGGGCTCCCCTCTTAATGT511–491
    Exon 2Forward: AGGAGTTCAAGACCAGCCTAAGCAACATG9456–948443660
Reverse: CCTGGGAAAACACAAAAAGAAAG9891–9869
    Exon 3Forward: AATCTCATTTATATGTACTTACATGCCAGT12137–1216641853
Reverse: GGTTCATATTCATACCAAAGAATGACATC12554–12526
    Exon 4Forward: CATGGAACCTGATTCGTTTGATTCTTATC15531–1555930557
Reverse: AACATTGCATCGTTCTGGTATGCAGGCC15835–15808
    Exon 5Forward: CCCATCCTCTGTAAGCAGTAGACTTGTC17362–1738929557
Reverse: CAGGAAGTGTTTCAGAACTGTGGTTCAG17656–17629
    Exon 6Forward: TCAAGACATGTAAAAATTGTTGTTGGTGC18543–1857134353
Reverse: CTACTTTGTCTAGAGCATGCACAATAGG18885–18858
    Exon 7Forward: CGGTACAGATCTAAGCATTAACATAGC32132–3215833660
Reverse: AGGACAGCAGAGTAAAATGGAAG32467–32445
    Exon 8Forward: CCTTTGCTTTCAAGTGGTGGTC38610–3863140063
Reverse: TAGGCAGAAATCCCCACAAACA39009–38988
    Exon 9First PCR:
Forward: CCACATTCTGTGTCAGCTATTGCTTCTC43272–4329978862
Reverse: CGATCTCAGCTCACTGCAACCTC44059–44037
Second PCR:
Forward: GTCTTCCAGGCAATATAGTGTTTCTACAG43480–4350838965
Reverse: AAGTGCTGGGATTACAGGTGTGAGTCACC43860–43832
    Exon 10Forward: AGGCTGCAGTGAGCTGAGATCATCCCAC53563–5359039763
Reverse: ATACTTTCCCATCCATTAAGGCATTTAGC53959–53931
    Exon 11Forward: ATGTGGCTGTTTTAACACTCTTGTGACAC58844–5887233463
Reverse: ATAGAATGCTTACACAATACAGAAGGCAC59167–59138
cDNA
    1Forward: GCGCTCCCTTCTCTGCCA222–23957957
Reverse: ACACCCTCTCCTAGTCCT800–783
    2Forward: CAGCAAAATAGGGGGGAAAA660–67964757
Reverse: CAGACAGGATCATACATAAC1306–1287
    3Forward: CCTGCCACTTTGGGCTAT1134–115169757
Reverse: TACAGAAGGCACTTTGAG1830–1813