Table 1

Factor I primer sequences, PCR annealing temperatures, magnesium concentrations, and sequencing conditions

Exon noForward primer sequenceReverse primer sequencePCR annealing temp. (°C)MgCl2 conc.Sequencing temp. (°C)
1ggaaacaagttcctattggtccttgttcagttcaatgcctct601.560
2aacaccatcctcatctgtacttactggaagacttttcactgg601.560
3ctgccgctgacacataataaatccaagtgttgggtaaacatg601.560
4gtttcttacctcgtacagtagtattattgcctctgtgactgg601.560
5–6atctgataaggatgtcatgccccatctatgttccccttaagat601.560
7cagctagacatcctacaattctgttcaggctgggttattact601.560
8acatgccttggggattttgtataaccagtgagccaccaata601.560
9–10tactaatgattccagcctgtcgctttatcatctgccacaatc601.560
11catgacagcaagcatttacaattatgcttctctctgagtgct601.560
12aaacacgctaaggaagagttcattagaggaagaaacctgagc601.560
13ttgttaaatgccatggaggaggacaggtactatgccaaacat601.560