Table 2

 Single nucleotide extension primers for MBL2 SNPs

SNP*Accession numberNucleotide sequence (5′→3′)
*The names of the alleles found at each polymorphic locus are given. The nucleotides for each allele are given in brackets; here the number refers to the polymorphic nucleotide position of the Genbank DNA sequence of the specified accession number given in the neighbouring column.
The length of the oligonucleotide might be increased by the addition of an A-tail.
A reverse oligonucleotide is used.
Y/X (425 g/c) AF080508AAAAAAAAAAAAAAAAAAAAAACAATGCACGGTCCCATTTGTTCTCACTGCCAC
A/D (868 c/t) AF080508GCATCAACGGCTTCCCAGGCAAAGATGGG
A/B (875 g/a) AF080508CGGCTTCCCAGGCAAAGATGGGCGTGATG
A/C (884 g/a) AF080508AAAAAAAAAAAAAAAACCTGGTTCCCCCTTTTCT