Table 1

Primer sequences for SNPs and microsatellites

MarkerForward primerReverse primerSize (bp)Annealing temperature
*These markers were amplified as one multiplex PCR, as described in Methods; †fragment is ~520 bp in length and was digested with HpaII prior to analysis on ABI377.
rs3086056 (HES6)GTTCACTCTGGCTCACCTCAATHEX-CCCACTGCCCCAATAGCTC95/10055°C
rs11165 (TWIST2)TTACTTTCACGCCGCTATTCTACGTCTTTATTTTTCCTGGGTGT/A SNP55°C
AC114788CA*GTTTCTTACTGGGATGCTGAGATATGGACFAM-CAAATCCACTTGTTGTCTGGTG260–29062.4°C
AC017028CA*HEX-TCAAAGTGCGCTGAGAGTGGGTTTCTTGTGGACAGATGTGGAAGTAGC90–12062.4°C
AC062017TGGCAAAGGTTCATACAGATACCGAHEX-CTGTCAAAGGAAAAAGGGAAGC160–18055°C
AC093802CAGTTTCACCAACTCAAATGCTAATCCAHEX-CAACATCAGTGTAACCATAAAACA170–19052°C
AC093802TTATFAM-TCACTCATCTTTGCCTGGATAGTTCATATTTACACGTAGAAGACGG230–250†55°C
AC013469CA*GTTTCTTATCCTATGGAACACCTCTCCCHEX-AATTCATCTGACCAAGCATGTG230–25062.4°C
AC124862CAGACGCATCACTCTACCTAAAAAAAHEX-CAATGCAGGTCTAAATGACCAG100–12055°C
AC005237CA*FAM-ATCAGCTACTGTCAATTCATTCGGTTTCACCCCTACTCCCAGAAGTCC80–12062.4°C
AC005104CA*GTTTCTTATACATGCACACACGACCACATET-GAACAAAGAACTGGACCCTCAG115–14962.4°C
AC093642CA*GTTTCTTGCAGTTAATCTTGACACATCAFAM-GGGAACAAAAAGAAGGCATGTA150–17062.4°C
AC131097CA*FAM-GTTAAGGGGCTGGACGGGGTTTCTTAGTCTCCTCGCTCGTGGC200–22062.4°C