Table 1

Primers and PCR conditions

Primers: name and sequence (5′→3′)
AmplimersSize, bpForwardReverseTa, °C
*Standard PCR reactions
†GC rich templates PCR reactions
Ta, temperature of annealing
Exon 1* 32035F: GGCTGAGCCATCCAGAACCT35R: CCTATATACGGGCGGAAAGGC62
Exon 2* 260PH2F: TGCCGGCTGATTTGCTCACPH2R: AGCGGGGTCGGTTTCCAGG58
Exon 3† 62710F: TGCTTCACCGTCTCTCCTTCC3.3R: TACCCGCTCGCCCACTCG60
Exon 3† 45822F: GCACTGACCCGGACAGCACT3.3R: TACCCGCTCGCCCACTCG60
Exon 3* 120145F: AACCCGGCAAGGGCGGC279R: GAGCCCAGCCTTGTCCAGG65