Table

Primers used for DNA sequencing of KIT and IL4-RA

Primer nameOligonucleotidePositionExon positionExon number
KIT exon1FGCATTAACACGTCGAAAGAGC6033–60536247–63341
KIT exon1RGTCCTCTCTCCGGATGCAC6411–6430
KIT exon2FGTGCTTTATTTCGCCAAGGA43708–4372743768–440372
KIT exon2RCCTTCTAGACCCAGCCAGAA44137–44156
KIT exon3FGGGCCACTAGTCATGAAAGG46435–4645446537–468183
KIT exon3RGGTGGATCAACGAGAAGAGAA46877–46897
KIT exon4FTTGCTGGTACCTTCAGATATG47714–4773447883–480194
KIT exon4RAGTCGAGGCAGTTTCAGGAC48094–48113
KIT exon5FTGGAGAAGTTAATTGCTGCTA51872–5189251976–521445
KIT exon5RCATTGCAAGAGGCTACAAGGA52279–52299
KIT exon6FGGAAATCAACCAATTGTTTTTG55263–5528455349–555386
KIT exon6RCGTGGATTTACGGGTTACAGA55609–55629
KIT exon7FCGTTGGTCCCAGATGGAATA57582–5760157673–577887
KIT exon7RTGCAGCTGTTACAAACACGA57839–57858
KIT exon8FCCTTTGAACTTGCTCCCTCA71696–7171571830–719448
KIT exon8RAAAGCCACATGGCTAGAAAAA72061–72081
KIT exon9FAAGTATGCCACATCCCAAGTG74025–7404574103–742849
KIT exon9RTGACATGGTCAATGTTGGAA74355–74374
KIT exon10,11FGGCTGTGAGTTGGGAGGTG75363–7538175464–7557010
KIT exon10,11RAACAAAGGAAGCCACTGGAG75852–7587175662–7578811
KIT exon12,13FATGGTCCTTCAATTCCACCA76006–7602576069–7617312
KIT exon12,13RAATCTAGCATTGCCAAAATC76430–7645076257–7636713
KIT exon14FTGACCACCCTTGGGTATTTT77465–7748477581–7773114
KIT exon14RGCCTTGATTGCAAACCCTTA77785–77804
KIT exon15FAGGGGATGAGGAGGTAGAGC79496–7951579574–7966515
KIT exon15RCCATTGGCACTGCTACCATA79778–79797
KIT exon16FGATCTGCCTGCAAGTTCACA79996–8001580117–8024416
KIT exon16RTGGCTCTAAAATGCTCTGTTC80320–80340
KIT exon17FTGAACATCATTCAAGGCGTA81142–8116181317–8143917
KITexon17RTGTTCAGCATACCATGCAAA81587–81606
KITexon18,19FCCACATTTCAGCAACAGCAG84594–8509284687–8479818
KITexon18,19RACCCTCAACATCTGGGTTTC85073–8509284910–8500919
KITexon20FTCCATATGTCCAGTTGCATAGC85249–8527085364–8546920
KITexon20RGCCCAATTTGCAACCTAAGA85579–85598
KITexon21FGGCCACAAAGTTCTTGGAAA86479–8649886617–8674521
KITexon21RAGAAAGACAGGATTGCAGTGG86856–86876
KIT816FGCAGCCAGAAATATCCTCCTTA
KIT816RGCAGGACTGTCAAGCAGAGAATG
KIT560FATCGTAGCTGGCATGATGTG
KIT560RGCCACTGGAGTTCCTTAAAGTC
IL-4RAFGAAACCTGGGAGCAGATCCT
IL-4RARGCCTTGTAACCAGCCTCTCC