Table 3

Primers and conditions used for mutation detection of HRPT2

ExonPCR-primers: 5′→3′Product size (bp)Annealing temp (°C)Sequencing primers: 5′→3′
ForwardReverse
Primers were constructed from alignment of the cDNA sequence (accession no. XM-029845) with the genomic sequence of AL390863 and AL139133.
Primers 1F and 17R are located within 5′ and 3′UTR regions, while all other primers are from within intronic sequences.
11FGAGGACGGCTGTTAGTGCT1RCCCCTTCTTTCCTTACCCTA451581F/1R/1SCGAAGGAGGAGGAGGAAGAG
22FTAAATGAATCCAGCCTGAAG2RAGGCCAGACCCTGTCTCT251622F/2R
33FAAAGTGCTGGGATTCTAGG3RTGGACAAAAATGAAGGTAGG599623SGTTGTGTATCATTGTTATTC
4–54FAACATGTTTTTGCAGAGCTG5RCTCCTCAGGTTACTGCAATC451624F/5R/4-5SACCTAGAGAAAATCACCATA
66FGGCCTAAAGACACTGATACC6RCGAACTTAAGAGCAAAGAGG351586F/6R
77FGAATGCCTGCTGTGAAAA7RTGTGAAGGAGCTTGCATTT502587F/7R
88FCTCTGGATCAATATCTTAGTAGTGG8RGTCTTCAACGTTACTACACTGC348588F/8R
99FATGGTCATGCTACTGCACTC9RCCAACCCTTACCCTTAAACA251589F/9R
1010FCAGAGATAGTCTTAACCAGCTTC10RCTTCAACATGTGCTACTCACAT3845810F/10R
1111FAACATGTTCAGTGGAGTAACC11RTGCACTGTTACGATCTTTTG2516011F/11R
12−1312FTGGTTAACTGAAACTGCAGA13RGTATCTCAATATCCTACGTACAGG7136012F/12SCAGTGTTGAGAAGATAGTTG
13R/13SCCCAAGCCACACTGATTATT
1414FATCTTCCCATTTTCATCACG14RCCCCATCTCTTAAAAAGCAA3215814F/14R
1515FTGCCTAAGGGATTTATAGTAGC15RACATCATATGCGCAGAACT2816015F/15R
1616FGGCGTGTATAAACCCTGAAT16RGAAAGAAGGGAATTAGGGAA4016016F/16R
1717FGAGGAGTGTTATTTCTAGCTTATTC17RGATCAATCTGTGACCTTCTTCA3016017F/17R