PCR-RFLP analysis of putative pathogenic MTND1 gene mutations in the three patients
Sequence variant | Primers | Primer sequences (5′ to 3′) | Restriction enzyme | Expected fragment sizes (bp) |
---|---|---|---|---|
Details of the oligonucleotide primers, restriction endonucleases, and expected fragment sizes following enzyme digestion are given. | ||||
For patient 3, primers have additional M13 sequence (shown in lower case), while mismatch nucleotides are in bold. | ||||
Patient 1 (3697G→A) | L3607–3627 | GGCCTCCTATTTATTCTAGCC | BclI | Wildtype: 189 →137 +52 |
H3795–37776 | GGAGAGGTTAAAGGAGCCAC | 3697G→A: 189 →103 +52 +34 | ||
Patient 2 (3946G→A) | L3875–3894 | TAGCAGAGACCAACCGAACC | TaqI | Wildtype: 157 →87 +43 +27 |
H4031–4011 | AAGATTGTAGTGGTGAGGGTG | 3946G→A: 157 →130 +27 | ||
Patient 3 (3949T→C) | L3928–3948 | tgtaaaacgacggccagtGTCTCAGGCTTCAACATCGTA | RsaI | Wildtype: 222 →188 +34 |
H4113–4094 | caggaaacagctatgaccCAGGGAGGTTAGAAGTACGG | 3949T→C: 222 →150 +38 +34 |