Table 1

PCR-RFLP analysis of putative pathogenic MTND1 gene mutations in the three patients

Sequence variant	Primers	Primer sequences (5′ to 3′)	Restriction enzyme	Expected fragment sizes (bp)
Details of the oligonucleotide primers, restriction endonucleases, and expected fragment sizes following enzyme digestion are given.
For patient 3, primers have additional M13 sequence (shown in lower case), while mismatch nucleotides are in bold.
Patient 1 (3697G→A)	L3607–3627	GGCCTCCTATTTATTCTAGCC	BclI	Wildtype: 189 →137 +52
Patient 1 (3697G→A)	H3795–37776	GGAGAGGTTAAAGGAGCCAC		3697G→A: 189 →103 +52 +34
Patient 2 (3946G→A)	L3875–3894	TAGCAGAGACCAACCGAACC	TaqI	Wildtype: 157 →87 +43 +27
Patient 2 (3946G→A)	H4031–4011	AAGATTGTAGTGGTGAGGGTG		3946G→A: 157 →130 +27
Patient 3 (3949T→C)	L3928–3948	tgtaaaacgacggccagtGTCTCAGGCTTCAACATCGTA	RsaI	Wildtype: 222 →188 +34
Patient 3 (3949T→C)	H4113–4094	caggaaacagctatgaccCAGGGAGGTTAGAAGTACGG		3949T→C: 222 →150 +38 +34