Table 1

Primer pairs for SSCP analyses

Primer nameSequence (5′-3′)PositionFragment sizeAnnealing tempPCR buffer
Buffer A: Red Taq buffer (Sigma, Zwijndrecht, The Netherlands); buffer A* is Red Taq buffer with final concentration of 1.2 mol/l Betain; buffer B: supertaq buffer (Sphaero Q, Leiden, The Netherlands).
Gsh12FGAGCACCTTGCCCGAGCCTTACC1496–1518364 bp56A
RCTCCTTGTCATCGTTGGCTGAGG1838–1860
Gsh13FTCCGAGGATGAGGACTCCCTGTC1810–1832370 bp56A
RCCCCATACAGTGTTAAACTTAA2159–2180
Gsh14FCAACTCATTCTTGTCGTATAAC2117–2138374 bp55B
RGCAGGAGAAGATAGGGAGAGCAA2159–2180
Gsh15FAGGGCAGAGCTTAGAACACTAGA234–256286 bp56A*
RAGTGCAGGTGCGAAGTGAC502–520
Gsh16FCCATTGGTGATGTCCGTGT427–445302 bpNDND
RCTGATGATGGTGATGGTGGT710–729
Gsh17FGTGAACCATGCGCATCATC673–691249 bp56A*
RAAAGGCGCGGAGCGCAGGTG903–922