Table 2

Y chromosomal STSs

STSLeft primerRight primerProduct size (bp)
Markers with an asterisk amplify DNA fragments from more than one genomic locus (see section “Restriction analysis of PCR products for detail”).
SKY1GGACATTTGGCTGCAGAGATTGGCAATGCACTCTCATCAT255
SKY2TCAGGACAGACAGGCTGCTACCTGCCACTGAGCTCCTTAC∼1700
SKY3TTCTCCCTCATCTTCCAAGCGCTTCCATCCATTAGCAAGG167
SKY4CCTTTCATTCCATTCTCTTCCACGCACTTTATGGACTGCAA111
SKY5*CCCTCGTCCATTTCTTTTGACCTCGAATTTAATGGATTGC202
SKY6*TCAATGGATGCACAGTGTGGCTCCACTGAATTCCATTGCAC328
SKY7GGGAGTGCAAAGGGAAAGATCTTTCCATGGGGTGACATTC223
SKY8CCATTCATTCGAGTTCATTACGATTGGAATGGAATCGGACAG189
SKY9GGCCGATGGTCAAACTGTTAGAAACGGGCTCTGAAATTCT531
SKY10*ATAAGGGGCAGGTTTGTCACGCTACTTATTCAGTGTTTAACTGACAC329
SKY11*AAAGTGGGTGAAGGACATGGTTTTTGTTTGTGGCAGGTG469
SKY12*TTGAGTCACTGGGGATAACTGTATGGCCCACAATCACTTCA216
SKY13*GGCAGCCTAGAAAGTCTTGTTCCCCTTGGGATTTTGTCTGTT198