Mutations identified in Chinese patients with MPS IIIB
| Mutation | Nucleotide alteration | Protein alteration | Patient | Allele | SSCP shift/ heteroduplex formation | Restriction enzyme (fragment sizes (bp))/ASO test |
|---|---|---|---|---|---|---|
| *Number of nucleotides according to Zhao et al.3 | ||||||
| †‡Found previously.3,5,7 | ||||||
| §The HinfI site generated by amplification created restriction site PCR using exon 2 forward primer and mismatch reverse primer (CCATTCAGCGCCATCCAGAC). | ||||||
| R130C | CGC-TGC | Arg-Cys | 1362 | Hom | − | −KpnI (419) |
| I154R | ATA-AGA | Ile-Arg | 1377 | Hom | − | +HinfI§ (379, 21) |
| 660delC* | 1 bp del | 17 altered aa, term | 773 | Het | + (heteroduplex) | ASO |
| Y309C | TAT-TGT | Tyr-Cys | 155 | Het | + (heteroduplex) | ASO |
| G412E | GGA-GAA | Gly-Glu | 155 | Het | + (heteroduplex) | ASO |
| R565W† | CGG-TGG | Arg-Trp | 2092 | Hom | + (heteroduplex) | ASO |
| 773 | Het | |||||
| R626X‡ | CGA-TGA | Arg-Stop | 1146 | Hom | + (SSCP) | +DdeI (125, 103) |