Table 2

Primer sets for exonic amplification of the human UMOD gene

Primer (5′→3′)Size (bp)PCR conditions*GenBank accession No
ExonForwardReverseSize (bp)PCR conditions*GenBank accession No
SDenotes primers also used in sequencing reactions. Sequencing was performed with BigDye Terminator System from ABI.
*The standard PCR amplification for each exon contains: Taq (0.025 U/μl), 1 × PCRx enhancer buffer, 25 nmol/l each dNTP, and 1.5 mmol/l MgSO4. A=5% PCRx enhancer. B=1 × PCRx enhancer buffer, no PCRx enhancer.
Cycling conditions=95-5’ + 94-30”/56-30”/72-90” 35X + 72-10’.
02–03TCCTGCTCCAAATGACTGAGTTCTTCAACCCAATGGAATGACCTCTTA888BAY162963
04–05GGTGGAGGCTTGACATCATCAGAGGGAATAGGGCTCAGATGGTCTTTG1493AAY162963
04–05SGCCCTGGCCTCATGTGTCAATGTGGGGTCACAGGGACAGACAGACAATAY162963
04–05SCGGCGGCTACTACGTCTACAACCTGTAGCTGCCCACCACATTGACACAAY162963
06ACCTCTGGACCTCAAGTAATCTGTTGATGCCTACTGGCTGAGACAATC940AAY162964
07ACCAGCAGATTTAGCTTTGAAGTCGCTTGAACCAGGCAGTGCTTTGAC475AAY162965
08AGCAGCATCCAGGCACTTGTCAGATGAGGCAGAAGAATCACTTGAACC711BAY162967
08STCCAAAGACCCCCTCTGAATTCTAAY162967
09ATTTGAATCCAGGAAGTCTGACTCGGCAAGCCACTGAAGTTCTCTGAG612BAY162968
10GAGCGGCTCAGAGAACTTCAGTGGCCCGTGTCCTGTGTTACATTCATC529BAY162968
11GAGCCCCTGATGGGTCTGAAGTAGTCTGAGCCACTCTCCTTATTTAGA345BAY162969
12TAGATTGGGCACTTCACAAGAATGACAGCAGAACCCAGTCTCACTGAG733BAY162970