Table 1

CSGE primers

ExonPrimer namePrimer sequence5′ end locationProduct length (bp)Annealing temperature (°C)
*Random nucleotides.
†Exon 65 was analysed in two fragments, A and B.
1R1F5′-GCGCACGGGTTGGGCTTGGGAATGG−27759560
R1RC5′-ACGAACGGGGTGGGGACTAAACAAC+154
2R2F5′-GGCCATCTCTTCCTCTTCTTCTTTTTTTTAAAGTATGG−6022760
R2R5′-CAAAAGGCCACATTCTAAGGCTC+84
3R3F5′-GATAGCAAAGTTCGTGAGGGACCTGAG−11534750
R3R5′-GGCAGAACAGAGAAGGCAGATG+133
4R4FN5′-TGTGAGCTGTTGCCAATCTATG−6424955
R4RN5′-CGAAGAAAATCCATCAGCACTTATCTC+89
5R5F5′-CCTTCCAGAGGACCACAAGTGTTAC−7926960
R5R5′-CAGGAAGTAGCCATGCAGACC+94
6R6F5′-CCTCTGCATGATGGTTCCTGC−6130955
R6R5′-CCAGAGCAAATAAGATTAATCCATTAATAATTCC+50
7R7F5′-ATATGGTAACATAATTGTGGAC−9827555
R7R5′-TTTGCCTGCCCCCACTACACC+51
8R8F5′-CTACTGACGAATGGTTTTATATTGTGTTCTAC−6324355
R8R5′-TTGTTATGGAACTGACTTACACAAACCATG+54
9R9FB5′-CCAGTGTGAAGTATGGAGCTG−9433155
R9R5′-CATCTGCATCATGCACATTGCC+79
10R10FB5′-GGATGACTTCTGTGGGCCTATG−7446760
R10RB5′-TCTCTGGAGAATAGGAAGCCTCCC+212
11R11F5′-TGCTCTGTTGTCACCAGACG−14437860
R11R5′-GGGTAAGTTGTTACAGCAGCA+93
12R12F5′-GGAACCCAGAAAGTCTTAGAATTATGAGG−7226755
R12R5′-CCATGGAACTCCTTTGAAGCC+75
13R13FB5′-CAAGATCATGAGTTTGCAAATGGAG−9537455
R13RB5′-GAATATCATGGAAAATTAGGCTTC+153
14R14FB5′-TGTCCCATCTTCTCCTTCCTTAG−16939755
R14RB5′-GTACTTTAAGTGGGGAGAATC+105
15R15F5′-GCTGCATATTATTTCCTATC−11537650
R15R5′-CTGACCCTGTTGGTTTGTTGCTC+138
16R16FB5′-TGAGTTACACCAGGGATGATGG−10834150
R16R5′-CTGTGAATTCCACAAATGCAAAGACCTC+79
17R17F5′-GGTGTAAGGTGACTCCCTGG−15735350
R17R5′-GCATCCCAGATACATGGCACAGTG+142
18R18F5′-TTCCTCCTGTAGCTCCTAAGG−11233050
R185′-CTCTAAGCTACTCAAAGGCAG+92
19R19F5′-GCTTGAATTGATCACGTCGTTATGAC−11032450
R19R5′-CAGGAGACTCTAATTCAGTC+88
20R20FB5′-GCAATTGGGGTCAAAGTTGAAG−8027660
R20R5′-CTTTTGCAGGAAAAGCTGAC+76
21R21FB5′-CTTAATGTCAGCTTTTCCTGC−15840260
R21R5′-CTTTGAAAATTCTCATGTGAGCCTAG+106
22R22F5′-CTATGTCAGAACTGCAAAGTCTGG−7620855
R22R5′-GACAGCTTTATCCAGTCCGAG+80
23F235′-GTTTTATGAACTTACCAGGTTC−11333255
R235′-ACCGAAGCTAAGTGCTCAG+95
24F245′-CAGCAAATTATTATGTGTGCAG−10541860
R245′-ATCAAGTAGAGTGCTGAGATC+85
25F255′-CAAGAACTTCCAACCTTCATG−10031360
R25R5′-ACAGCCTTAATTCTTGCGACA+87
26R26F5′-CTTAAGGGCCAGGAGAGGG−11232160
R26R5′-ACCTGGAACATAGGCTATGAG+80
27R27FB5′-GGAGGAGTGCTTGGTCTGG−12127660
R27RB5′-CAAACATAAGCTTCCAACTTTGGC+81
28R28F5′-CGTGTATCGGTAAGGAGAAAGAC−12137355
R28R5′-ACAAAACTCAGAGTACATAGAG+128
29R29F5′-GCCCTGCCTCTTAAATAGTG−11032760
R29R5′-GACTCAAGCCTGCTTGACTCC+93
30F305′-AATAGTCTTATGCTAGTAGGC−11333555
R30RB5′-GGAATCTTTCTATCACTGACCC+96
31R31F5′-GTTATTATGTCTCGAGGGGAAAG−7527655
R31R5′-CATGTATCAATCTATAATTATGATACCAATCTC+75
32R32FB5′-7 bp(CAGGACG) + CCAAAAGACATTTGTGCTGAGCC−53 (+7 bp)*30655
R32RC5′-TAACAGAAAGGGTGGTATTTAAAACC+124
33R33FB5′-GTAGGAAAGTAACAGAGGTTGC−14633055
R33RB5′-AATGTGGAATGCCTGGCTTCTCTGACTAGTG+60
34R34F5′-CATTGCTGCACTGGAAAGTTG−8728150
R34RB5′-CAGGAATGTTTAAATAACCTAATCTC+68
35R35F5′-GTCTATAGGAGAAGTGCCCAG−13934860
R35R5′-GCCCTTGTGTAGTCCCAG+85
36R36F5′-TATCTCTGAAGTGGAAGACTGC−15535655
R36R5′-TGAGAATGGAATGTTTGGTGCTG+78
37R37F5′-CGGTAGTGTATAATGTTCATGGG−14643660
R37R5′-CTCTACAGGGCTGAGAGGAC+125
38R38F5′-GTGGCCTTGCACTGGGGACAC−20940255
R38R5′-CCTGGTAGCTCCTGGCACTCA+124
39R39F5′-GGAGGGGAAGGTTTCCGACC−14241355
R39R5′-ATGTGAGACATATCTACCTGGC+145
40R40F5′-GTCAACATTCATTAAGTATCAGGCC−7930560
R40R5′-CAGTCTGATGAGTAACATCACC+103
41F415′-GCTTGTTGAGTATCCACTTAG−8732460
R41R5′-CGCTAAGACTGATTTCCCCAAC+78
42R42F5′-TTTTTTCAGTCCAATTATTGTTCTTTGCTGACCCCTATCC−7031360
R42R5′-GCTGCACAGGGTGTTTGCACAG+171
43R43F5′-TTTCCATCTTGTCTTACCCTGCAC−7333055
R43R5′-CCATGCCCTTTACTATTTCTAGAG+131
44R44FB5′-CGAAGGACATCTTGGTTGCTTCC−17937160
R44R5′-CCAGATATCTGAAGCTTCATGAAGAC+69
45R45FB5′-CTCCTGAGAATGATAGCTAGAAG−8327555
R45R5′-CCATATTTAGAATCAAATGAAGCTTTCAACAGC+66
46F465′-AAGTTCTCAGCCTATGGATG−11938960
R46R5′-GAGCACATTGTATTTGACAAGTC+154
47R47F5′-TTGGCTAAGCCAGCAAAGGC−12532950
R47R5′-AGAACAGAGACTGCATGATTCC+76
48R48F5′-CTCCATGGTGGAATTTTATGAAC−7637955
R48RB5′-TGCCCTTGCATTTGTTTCTG+123
49R49F5′-GGAAACTCAGTTGCCCTTTGTG−9931455
R49RC5′-AAAAAACAGAGCTTTGCCATG+89
50R50F5′-AAGGAGTATTGCTGTGGTCCTG−12536160
R50R5′-CTGTCTTTAAGGCCTACAGTC+86
51F515′-CTTGTGGAGAAGCTTGTAATG−6419950
R51R5′-AAGAATAACTAGAGAAGAAGCAG+69
52R52FC5′-CTCAGTATTCTCAATCTGCTTCTTCTC−21341855
R52RC5′-GGTACCTATATTCATGGCTATACAGTG+88
53R53FB5′-AGCACTGCAGTCTGGATGTC−14033060
R53R5′-GACTTGTAATCAACCAATTGTTCCC+70
54R54FB5′-ATCCATGTTTATGACAATGAAGC−12332250
R54RB5′-AAGGGAAGCTTTGAGGGACATC+76
55R55FB5′-GAGATCATACTCAACAGAGCAG−15536555
R55R5′-AGAACTCAGAGCCCAGGTTCC+79
56R56FN5′-GCTCCATCCTCTATAAAATGGTCAGATG−6624260
R56RS5′-CCCAGTGTGGAGGCTGAGGTTAGG+49
57R57F5′-CTTGCTTCTTCTCACCCAGGGTAAAGTG−12843555
R57RC5′-CCTAGGCACATATTGCAAACTCC+100
58R58FB5′-TACACTGAAGTGACCCCCTAC−7826455
R58RB5′-20 bp + ATTTCCACTTGAGGATAAGCCATCAG+40 (+20 bp)*
59R59F5′-GTTAGACCCTGTGGAAATTGAGC−7528260
R59RB5′-GCTTGCCTGTGGAGTTCTTAC+84
60R60F5′-CCAAATCAGACGTGGAGCTGCTTCATAG−9128855
R60RC5′-CCCAACAGCAGAGGAAATAGAAAATAATCCC+80
61R61FB5′-GCCTTATTTGGCCTTTTCCGAGTTATCC−10531460
R61RB5′-GATGATGAAGGTGCCAATAGCC+80
62R62FB5′-GGTAGAATAATGTGTAGGATGTG−10836855
R62R5′-GGGTTTCAACCAGGTTAGGG+140
63F635′-CAAGTGGCCAGATCCAATG−7641760
R63R5′-CAAAAAGCATGGTTCTCCTCTGC+109
64R64F5′-CTCACAACTGCAAGGAACAGGC−9835055
R64RB5′-TCCTTGGAGGAAACCACAGG+77
65A†R65AF5′-GTGTATGCAGCATAAGGCAG−12235260
R65AR5′-TTGTGAAGTGGAGGTAGCTG+230
65B†R65BF5′-TTCCAGCTCTTACAACTCTGAC+13843960
R65BR5′-GTCACCTGTACCTTGCTTTGG+164