Table 1

Primers and PCR conditions used for the MECP2 coding sequence screening

ExonsPrimersAnnealing T (°C)PCR product (bp)
1F : ATTTTCTTTGTTTTAGGCTCCA50185
R : GGCCAAACCAGGACATATAC
2AF : GGCATGTTCTCTGTGATACT58182
R : TGCCTCTGCGGGCTCAGCA
BF : AAGAGAAAGAGGGCAAGCAT58296
R : CTGTAGAGATAGGAGTTGCT
3AF : TGTGTCTTTCTGTTTGTCCC58181
R : GATTTGGGCTTCTTAGGTGG
BF : CCTCCCGGCGAGAGCAGAAA64243
R : TGACCTGGGTGGATGTGGTG
CF : TGCCTTTTCAAACTTCGCCAG58280
R : TTGACCTCGATGCTGACCGT
DF : GATCTGTGCAGGAGACCGTA62250
R : TTTGGGGACTCTGAGTGGTG
EF : GCAGCAGCAGCGCCTCCTCA68264
R : TGGCAACCGCGGGCTGAGTC
FF : TGCCCCAAGGAGCCAGCTAA64202
R : GCTTTGCAATCCGCTCCGTG