Table 1

PCR primer sets for amplifing exons of MECP2

Exon Primer sets PCR product (bp)
Exon 1F5′ ACAGAGGCCAAACCAGGAC 3′416
R5′ TAGAGGTGACAAGGCTTGTG 3′
Exon 2F5′ CTCCATGAGGGATCCTTGTC 3′463
R5′ AGACTGGCATGTTCTCTGTG 3′
Exon 3-1F5′ ACATTGCTATGGAGAGTTCTC 3′427
R5′ GTTTGATCACCATGACCTGG 3′
Exon 3-2F5′ GAAGCTCCTTGTCAAGATGCC 3′477
R5′ TTTGGGGACTCTGATGGTG 3′
Exon 3-3F5′ ACTGAAGACCTGTAAGAGCC 3′632
R5′ AATGCTCCAACTACTCCCAC 3′
  • F: forward primer, R: reverse primer.

  • DNA sequence cited from Gen Bank accession number AJ132917.