Table 1

Oligonucleotide sequences flanking each of the exons of the MYL2 and RPL6 genes

Forward 5′-3′Reverse 5′-3′
MYL2
Exon 1CTCACCTATGACTGCCAAAAGCCCTCGCTTGTAGTGGCTTC
Exon 2CCCAGAGTAGGGGCCTGACCTAGCCATCCAGGCGGATGATTCAATAG
Exon 3CCAGGCTGAGCTGCCAATCACCATGCAGGGCTAGAGAGGGGT
Exon 4CCCTGAGTGTGTGTTTCCTACCCTTCTGCCAGCCCCCCCGAAGAA
Exon 5CCCAGCCACCCCCAGTACATGTCCCGAACGCTGCAGAGAAAGGA
Exon 6GACACCAACACCTGCTTTCCTTTCGGAGAACCAGGAGCTGGGTTAGAGG
Exon 7CTTAGCACGTGTTGCTGGCTCACACTCTGCAAAGACGAGCCCA
RPL6
Exon 1CCGGCCTAGGATTTACTACTCAGTTAGCCTTGGACATG
Exon 2TTGTTAGAGAGATGACTGGTGCAATTAAGGTTAAGACATAATGG
Exon 3CTTAATTGGCATTCTCTTACTGTTCAAGCATAAACAGGAAATCC
Exon 4GCTTCTAGTAATCTGAATGGCGCAGCTGCAGTGAAGCGC
Exon 5GATGCCTGTGATTTTATGAATTCAAGTTTCACAGAACATCAC
Exon 6CACCTAAATTGCAGGATGATGCAGTGCTAACACAGGAGATG
Exon 7AAGTAATTTGGTATGTGCCTGAGTCAGCTATTTAATTAGGTTC