You are here

  • Home
  • Online First
  • Familial periventricular nodular heterotopia, epilepsy and Melnick–Needles Syndrome caused by a single FLNA mutation with combined gain-of-function and loss-of-function effects

Article Text

Article menu

other Versions

Genotype-phenotype correlations
Original article
Familial periventricular nodular heterotopia, epilepsy and Melnick–Needles Syndrome caused by a single FLNA mutation with combined gain-of-function and loss-of-function effects
  1. Elena Parrini1,
  2. Davide Mei1,
  3. Maria Antonietta Pisanti2,
  4. Serena Catarzi3,
  5. Daniela Pucatti1,
  6. Claudia Bianchini1,
  7. Mario Mascalchi4,
  8. Enrico Bertini5,
  9. Amelia Morrone3,6,
  10. Maria Luigia Cavaliere2,
  11. Renzo Guerrini1
  1. 1Pediatric Neurology and Neurogenetics Unit and Laboratories, Neuroscience Department, A. Meyer Children's Hospital—University of Florence, Florence, Italy
  2. 2Medical Genetic Unit, AORN Cardarelli, Naples, Italy
  3. 3Molecular and Cell Biology Laboratory, Pediatric Neurology and Neurogenetics Unit and Laboratories, Neuroscience Department, A. Meyer Children's Hospital, Florence, Italy
  4. 4Quantitative and Functional Neuroradiology Research Program, Meyer Children Hospital and Careggi General Hospital, Florence, Italy
  5. 5Unit of Neuromuscular and Neurodegenerative Disorders, Laboratory of Molecular Medicine, Bambino Gesù Children's Research Hospital, Rome, Italy
  6. 6Department of Neurosciences, Psychology, Pharmacology and Child Health, University of Florence, Florence, Italy
  1. Correspondence to Professor Renzo Guerrini, Neurology and Neurogenetics Unit, Children's Hospital A. Meyer-University of Florence, Viale Pieraccini 24, Firenze 50139, Italy; renzo.guerrini{at}meyer.it

Abstract

Background Loss-of-function mutations of the FLNA gene cause a neuronal migration disorder defined as X-linked periventricular nodular heterotopia (PNH); gain-of-function mutations are associated with a group of X-linked skeletal dysplasias designed as otopalatodigital (OPD) spectrum. We describe a family in which a woman and her three daughters exhibited a complex phenotype combining PNH, epilepsy and Melnick–Needles syndrome (MNS), a skeletal disorder assigned to the OPD spectrum. All four individuals harboured a novel non-conservative missense mutation in FLNA exon 3.

Methods In all affected family members, we performed mutation analysis of the FLNA gene, RT-PCR, ultradeep sequencing analysis in FLNA cDNAs and western blot in lymphocyte cells to further characterise the mutation. We also assessed the effects on RT-PCR products of treatment of patients’ lymphocytes with cycloheximide, a nonsense mediated mRNA decay (NMD) inhibitor.

Results We identified a novel c.622G>C change in FLNA exon 3, leading to the substitution of a highly conserved aminoacid (p.Gly208Arg). Gel electrophoresis and ultradeep sequencing revealed the missense mutation as well as retention of intron 3. Cycloheximide treatment demonstrated that the aberrant mRNA transcript-retaining intron 3 is subjected to NMD. Western blot analysis confirmed reduced FLNA levels in lymphocyte cells.

Conclusions The novel c.622G>C substitution leads to two aberrant FLNA transcripts, one of which carries the missense mutation, plus a longer transcript resulting from intron 3 retention. We propose that the exceptional co-occurrence of PNH and MNS, two otherwise mutually exclusive allelic phenotypes, is the consequence of a single mutational event resulting in co-occurring gain-of-function and loss-of-function effects.

  • Periventricular nodular heterotopia
  • FLNA
  • epilepsy
  • Melnick-Needles syndrome
  • mutation

https://doi.org/10.1136/jmedgenet-2014-102959

Statistics from Altmetric.com

    Request Permissions

    If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

    Introduction

    Filamin A (FLNA) is a ubiquitous actin-binding protein involved in cytoskeletal organisation. Mutations in FLNA were first detected in periventricular nodular heterotopia (PNH, OMIM: #300049),1 a neuronal migration disorders consisting of nodules of grey matter located along the lateral ventricles.2 PNH, due to FLNA mutations is often associated with epilepsy of variable severity, and with normal to borderline intelligence.3 ,4 Additional neurological and extraneurological features have been associated with FLNA-related PNH, including vasculopathy and/or coagulophaty,3 cardiac anomalies,5 Ehlers–Danlos syndrome6 and lung disease.7 Mutations in FLNA are also associated with a group of X-linked skeletal dysplasias designated as otopalatodigital (OPD) spectrum.8 The OPD spectrum includes OPD syndrome types 1 and 2 (OPD1, OMIM: #311300 and OPD2, OMIM: #304120), frontometaphyseal dysplasia (FMD; OMIM: #305620), Melnick–Needles syndrome (MNS; OMIM: #309350)8 and other syndromes featuring osseous dysplasia with intellectual disability, such as terminal osseous dysplasia9 and the FG syndrome.10 All but one FLNA mutations in OPD-spectrum disorders are missense mutations or small deletions/insertions conserving the reading frame and clustering in specific domains of the gene.11 The single exception is represented by a substitution in exon 45 of FLNA identified in a patient exhibiting a dual phenotype including PNH and FMD.12 The dual phenotype was attributed to the coexistence of the wild-type transcript and two additional aberrant transcripts, including a full length mRNA with a missense mutation (p.L2439M), and a shorter transcript resulting from a newly created splice donor site.

    Here we report a family in which a woman and her three daughters exhibited a complex phenotype combining PNH, epilepsy and MNS. All four individuals harboured a novel non-conservative missense mutation in exon 3 of FLNA. To uncover the genetic mechanism(s) leading to this complex phenotype, we performed a RT-PCR study coupled with ultradeep sequencing on FLNA cDNAs and western blot analysis in lymphocyte cells, and demonstrated that the novel substitution resulted in two aberrant transcripts, one carrying the missense mutation and a second one, which was longer, generated from intron 3 retention.

    Methods

    As part of a research project investigating the correlations between epilepsy, associated clinical features and underlying genetic causes, we were referred a proband (III:3, figure 1) exhibiting epilepsy, and a peculiar phenotype associating dysmorphic features and skeletal abnormalities, consistent with MNS (figure 2, see online supplementary figure S1). MRI of the brain showed PNH (figure 3). Clinical evaluation of the remaining family members (II:6, III:4, III:5) (figure 1) revealed that PNH, similar dysmorphic features and skeletal abnormalities were also present in the proband's sisters and mother (figures 2 and 3, table 1). Epilepsy was present in all three sisters but not in the mother (table 1). Although clinical features observed in this family (table 1) were fully consistent with MNS, PNH had not been previously associated with this syndrome.

    View this table:
    Table 1

    Clinical data of the four affected individuals

    Figure 1
    Figure 1

    Pedigree of the family. Squares=men; circles=women; arrow=proband; filled black symbols=patients with periventricular nodular heterotopia and Melnick–Needles syndrome; white symbols=unaffected individuals; ^=tested for FLNA mutations; triangle=abortion; /=deceased.

    Figure 2
    Figure 2

    Pictures showing skeletal dysmorphisms of affected individuals. (A) Patient II:6. Skull X-ray showing skull base sclerosis. (B) Patient II:6. Forearm X-ray showing bowing of the right radius with cortical irregularity. (C) Patient III:3. Chest X-ray showing mild wavy deformation of the clavicles with irregular contour and expansion of the end (black arrows). (D) Patient III:3. Chest X-ray showing scoliosis of the spine and bowed humerus (black arrow). (E) Patient III:5. Pelvis and hips X-ray showing supra-acetabular constriction of the pelvis with flaring of the ilia (black arrows).

    Figure 3
    Figure 3

    Brain MRI scans of the 4 affected individuals. (A–D) Patient II:6. Axial FLAIR (A, B) and T2W (C and D) images showing multiple contiguous and noncontiguous bilateral nodules of grey matter heterotopia (black arrows and white arrows) lining the lateral ventricles and protruding into the ventricular space. (E and F) Patient III:3. Axial T2W images. These images were acquired with a lower resolution scan. There are bilateral nodules of grey matter heterotopia protruding into the ventricular space (white arrows). (G and H) Patient III:4. Coronal T2W image (G) and axial FLAIR image (H) showing bilateral asymmetric but almost contiguous nodules of periventricular heterotopia (white arrow and black arrows). (I–L) Patient III:5. Axial FLAIR (I and J) and T2W (K and L) images showing multiple bilateral, mainly noncontiguous heterotopic nodules (white arrows).

    We performed mutation analysis of FLNA in the proband (III:3) and extended the genetic study to the remaining family members (II:6, III:4, III:5) (figure 1). Approval for the study was obtained from the institutional review board of the Meyer Children's Hospital, Florence, Italy. Clinical information and blood/DNA samples were obtained after informed consent.

    In order to elucidate the molecular mechanism underlying the complex phenotype, we performed RT-PCR on the FLNA cDNA, and western blot analysis in lymphocyte cells of all individuals. We subsequently performed ultradeep sequencing of the FLNA cDNA to further characterise the mutation.

    Mutation analysis of the FLNA gene

    We extracted DNA from peripheral blood leucocytes using a QiaSymphony SP robot (Qiagen, Hilden, Germany) according to the manufacturer's protocol. The 48 exons covering the coding regions of FLNA (Reference sequence: NM_001110556.1) and their respective intron-exon boundaries were amplified by PCR. Primer sequences and PCR conditions are available on request. PCR products were cycle sequenced on both strands using the BigDye Terminator V.1.1 chemistry (Applied Biosystems, California, USA) and run on a 3130XL genetic analyser (Applied Biosystems, California, USA). Mutations are described at nucleotide level according to the FLNA cDNA sequence (NM_001110556.1).

    X-inactivation studies

    In view of previous reports indicating that females with FLNA mutations leading to MNS exhibit skewed X-inactivation as opposed to random X-inactivation associated with PH-causing mutations,8 ,11 we tested the pattern of X-inactivation (XCI) in the four affected individuals. We performed the androgen receptor assay, as described previously, using a fluorescent-labelled primer on leucocyte-derived DNA.13 PCR products were analysed on an ABIPRISM 3130XL analyser (Applied Biosystems, California, USA). XCI ratios were calculated as (d1/u1)/(d1/u1þd2/u2), where d1 and d2 were the peak areas of smaller and larger alleles, respectively, from the digested sample and u1 and u2 were the corresponding alleles from the undigested sample.14 All the restriction digestion and amplification reactions were run in quadruplicate, and the average of four runs used for analysis. X-inactivation was classified as random (ratio<80:20) or skewed (ratio ≥80:20).

    In-silico splicing analysis and nucleotide conservation assessment

    We used three different tools to predict the impact of the identified mutation on the splicing process: Mutpred Splice (http://mutdb.org/mutpredsplice/about.htm), Splice Site Prediction by Neural Network (http://www.fruitfly.org/seq_tools/splice.html) and NetGene2 (http://www.cbs.dtu.dk/services/NetGene2).

    We used the University of California, Santa Cruz (UCSC) genome browser (http://genome.ucsc.edu/index.html) to assess the conservation of the nucleotide involved in the mutation using the 100 vertebrates Basewise Conservation by PhyloP (phyloP100wayAll) and the Genomic Evolutionary Rate Profiling (GERP) Scores for Mammalian Alignments (allHg19RS_BW).

    RT-PCR and ultradeep sequencing analysis

    Total RNA was isolated from blood samples, collected in a PAXgene tube (Preanalytix, Hombrechtikon, Switzerland), using the PAXgene Blood RNA Kit (Qiagen, Hilden, Germany) and including the DNase treatment for removal of gDNA. RT was performed using 1μg of total RNA with random primers and the SuperScript II Reverse Transcriptase kit (Invitrogen, Carlsbad, California, USA). The obtained cDNA was amplified using a forward primer in exon 2 (5′-CGAGAGCATCAAACTGGTGT-3′) and a reverse primer in exon 5 (5′-GTCCACAATCTCCTCGGGG-3′), and subsequently analysed on a 1.8% agarose gel.

    To perform ultradeep pyrosequencing with a GS Junior platform (Roche, Carlsbad, California, USA), cDNA was amplified using two fusion primers pairs to generate FLNA amplicon libraries. The fusion primer consisted of three portions fused together: the library adaptor (A or B) including the library key, the multiplex identifier (MID) and the gene-specific sequences. The 5′-portion was represented by one of the two adaptors (TiA: CGTATCGCCTCCCTCGCGCCA or TiB: CTATGCGCCTTGCCAGCCCGC) required for library sequencing, and the sequencing key ‘TCAG’. The inner portion was represented by one of the four MIDs (we used the MID4: AGCACTGTAG, MID5: ATCAGACACG, MID6: ATATCGCGAG and MID7: CGTGTCTCTA) of 10 bp from the standard Roche set, placed after the key, that were used to barcode the four samples. The 3′-portion was designed to target a specific sequence on FLNA exon 2 (5′-CGAGAGCATCAAACTGGTGT-3′) and exon 5 (5′-GTCCACAATCTCCTCGGGG-3′), resulting in a 400 bp cDNA amplicon. The MIDs, used both on forward and reverse primers of each pair, allowed for bidirectional sequencing. PCR amplifications were performed in a 25 μL final volume using the FastStart High Fidelity DNA polymerase (Roche, Carlsbad, California, USA). The PCR products were purified with the QIAQUICK PCR purification kit (Qiage, Hilden, Germany) and quantitated by fluorometry using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen, Carlsbad, California, USA), as described by the manufacturers. The four amplicon libraries were equimolarly pooled to obtain a FLNA multiplexed library at 1×106 molecules/μL. Emulsion PCR of the FLNA multiplexed library was carried out using the GS Junior Titanium emPCR Kit (Lib-A) and pyrosequenced on the GS Junior platform (Roche, Carlsbad, California, USA). An input of 0.3 molecules of library DNA per capture bead was used and 500 000 enriched beads were loaded on the instrument. The library was sequenced in a Titanium PicoTiterPlate (PTP) with titanium reagents, and base calling was performed with the amplicon filter settings. Processed and quality-filtered reads were analysed with the AVA software (Roche, Carlsbad, California, USA).

    Nonsense-mediated mRNA decay assay in lymphocytes

    In order to assess nonsense-mediated mRNA decay (NMD), we treated patients’ lymphocytes with cycloheximide, an NMD inhibitor.15 For each patient, we split lymphocyte cells into two batches, one to be treated with 100 μg/mL cycloheximide for 16 h (Sigma-Aldrich, Saint Louis, Missouri, USA) and one to be used as control. Lymphocytes were then harvested and washed twice with phosphate buffered saline buffer. Total RNA was then extracted from both treated and non-treated cells. RT-PCR products were run on agarose gel to evaluate differences between cycloheximide-treated and non-treated control cells.

    Western blot analysis

    FLNA western blot was performed in lymphocyte cells of all four affected individuals. Cells were lysed in icecold Radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris/HCl pH 7.5, 1% Triton X-100, 150 mM NaCl, 100 mM NaF, 2 mM ethylene glycol tetraacetic acid (EGTA) and protease inhibitor cocktail P8340 Sigma), and after 15 min on ice were centrifuged at 11 600 g for 10 min. Protein concentrations were determined on the supernatants by the bicinchoninic acid (BCA) method (Sigma Aldrich, Saint Louis, Missouri, USA). Equal amounts of total proteins (20 µg) were loaded in each line and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS/PAGE) on 6% (w/v) gel and electrotransferred to nitrocellulose membrane (GE Healthcare, Little Chalfont, Buckinghamshire, UK) that was probed with anti-FLNA monoclonal antibodies (Abnova, clone 4E10-1B2, diluted 1:1000) and anti-b-actin polyclonal antibodies (Sigma Aldrich, Saint Louis, Missouri, USA) to normalise and perform densitometric analysis. Secondary antibodies conjugated to horseradish peroxidase were used to detect antigen-antibody complexes with a chemiluminescence reagent kit (GE Healthcare, Little Chalfont, Buckinghamshire, UK). Chemidoc-Quantity-One software (Biorad Laboratories, Hercules, California, USA) was used to perform quantitative analyses. Values of the bands were expressed as percentage variations relative to those of control cells.

    Results

    Mutation analysis

    In the proband (III:3), sequence analysis identified a heterozygous c.622G>C nucleotide change (figure 4A) in FLNA exon 3. This change leads to the aminoacidic substitution p.Gly208Arg in the N-terminal domain of the protein. Sequence analysis of exon 3 revealed that the proband's sisters (III:4 and III:5) and mother (II:6) were heterozygous for the p.Gly208Arg mutation (figure 4A). This mutation was neither found in 250 control DNA samples of mixed ethnic origin nor in the ESP6500 database (http://evs.gs.washington.edu/EVS/). Bioinformatic analysis using the Polyphen (http://genetics.bwh.harvard.edu/pph/), PMut (http://mmb2.pcb.ub.es:8080/PMut/), and SIFT (http://blocks.fhcrc.org/sift/SIFT.html) programs predicted the amino acid substitution to be pathogenic.

    Figure 4
    Figure 4

    (A) Sequence electropherograms from FLNA genomic DNA of the four affected individuals, showing the heterozygous C>G substitution at nucleotide 622 (black arrows). (B) Agarose gel electrophoresis of products obtained from all affected individuals (II:6, III:3, III:4, III:5) and from two healthy female controls (C1 and C2), showing an aberrant fragment (AF) in all patients, but not in controls. EF: expected fragment; MW: 100 bp molecular weight marker; NT: no template control. (C) Sequence alignment of abnormal FLNA cDNA sequence with the reference genomic DNA, showing the c.622G>C missense mutation and the intron 3 retention.

    X-inactivation study

    X-inactivation was random in individuals II:6 (ratio, 66:34), III:4 (ratio 75:25); and III:5 (ratio 70:30) and slightly skewed in individual III:3 (ratio, 87:13).

    In-silico splicing analysis and nucleotide conservation assessment

    All the three different tools (Mutpred Splice, Splice Site Prediction by Neural Network and NetGene2) we used to predict the impact of the c.622G>C mutation on the splicing process revealed loss of the 5′ donor splice site of exon 3 and consequent intron 3 retention (see online supplementary figure S2). This aberrant transcript was predicted to result in a frameshift mutation leading to a premature stop codon 37 amino acids downstream (p.Leu209GlufsTer37).

    The nucleotide position involved in the substitution (chrX:g.153596210G>C) showed a 100-vertebrates Basewise conservation score of 7.72 and a GERP score of 5.13, indicating a high evolutionary conservation of the nucleotide.

    RT-PCR and ultradeep sequencing analysis

    We amplified by RT-PCR a 400 bp cDNA fragment containing exons 3 and 4 and parts of the flanking exons (2 and 5). The amplicons obtained were analysed with agarose gel electrophoresis. An additional cDNA fragment of about 500 bp was present in all patients, but not in two healthy women we used as controls (figure 4B).

    We pyrosequenced the FLNA multiplexed libraries obtained from the cDNA, and observed reads of 400 bp corresponding to transcripts carrying either the wild-type allele or the allele with the missense mutation. Additionally, we observed longer reads corresponding to the aberrant fragment obtained after gel electrophoresis and resulting from retention of intron 3 (figure 4C).

    We evaluated the amount of the aberrant codon leading to the missense substitution on the reads of 400 bp. The 400 bp reads carrying the c.622G>C mutation were: 76 out of 2199 in Patient III:3 (3.5%), 130 out of 2004 in Patient III:4 (6.5%), 50 out of 662 in Patient III:5 (7.5%) and 150 out of 2312 in Patient II:6 (6.5%).

    NMD assay

    Agarose gel electrophoresis of the RT-PCR products obtained from cycloheximide-treated and non-treated lymphocytes showed marked differences. In particular, the amount of the aberrant transcript retaining intron 3 was higher in cycloheximide-treated cells, clearly demonstrating the aberrant transcript to be subjected to NMD (see online supplementary figure S3).

    Western blot analysis

    Western blot using FLNA monoclonal antibodies showed reduced protein levels in lymphocyte cells of affected individuals compared with controls (figure 5).

    Figure 5
    Figure 5

    (A) Western blot analysis with anti-FLNA antibodies on lymphocyte lysates of the four affected individuals. (B) The same filters were also probed with anti-β-actin antibodies for cell lysate normalisation. ctrl: pool of lymphocytes from five healthy controls; III:5, III:3, III:4, II:6, lymphocytes from patients. FLNA normalised values, obtained by densitometric analysis, are reported as mean percentage±SE relative to the value obtained in control cells (100%) of three independent experiments.

    Discussion

    Filamin A is a homodimer with a conserved actin-binding domain (ABD) consisting of two calponin homology sequences (CH1 and CH2) at the amino-terminal (N-terminal);16 24 Ig-like repeats separate the ABD from a carboxyl-terminal (C-terminal) domain, with two intervening calpain-sensitive ‘hinge’ sequences separating repeats 15 and 16 (hinge 1) and repeats 23 and 24 (hinge 2).17 FLNA crosslinks actin filaments into orthogonal networks and is involved in the anchoring of membrane proteins to the actin cytoskeleton by interacting with integrins, transmembrane receptor complexes, ion channels and second messengers.18

    Various reports have stressed the remarkable phenotype heterogeneity associated with FLNA mutations,4 ,11 ,19–22 with males often exhibiting severe phenotypes in relation to multiorgan, especially cardiovascular and intestinal, involvement.19 ,22 ,23 The wide spectrum of phenotypes reflects the complex protein structure and, in particular, its interaction with actin and various membrane receptors.24

    FLNA-related PNH affects predominantly females and is associated with high rates of early prenatal lethality in males.1 ,25 Almost 100% of families and 26% of sporadic patients with PNH harbour FLNA mutations.4 ,26 X-linked PNH is allelic to the OPD spectrum disorders, a group of skeletal dysplasias exhibiting varying combinations and severity of undertubulation of long bones, cortical irregularity and campomelia.8 Although all four recognised OPD conditions exhibit phenotypical overlap, both qualitative and quantitative differences make their clinical distinction possible in most patients.11 Mutations that lead to the OPD spectrum are substitutions or small in-frame deletions of amino acid residues that occur in specific regions of the FLNA protein and do not lead to its down-regulation of expression.27 This mutational mechanism distinguishes the mode of pathogenesis for the OPD spectrum disorders from X-linked PNH, which is associated with loss-of-function mutations.3

    Four affected individuals of the family we are reporting here exhibited a recognisable MNS phenotype (figure 2 and see online supplementary figure S1), associated with bilateral PNH, and with epilepsy in three (figure 3). Patients with MNS do not usually have PNH or epilepsy. MNS is part of the OPD spectrum and is an almost entirely female-limited entity due to embryonic or perinatal lethality in males.8 Females have distinctive facial dysmorphisms (supraorbital hyperostosis, hypertrichosis, exorbitism, full cheeks, micrognathia), thoracic hypoplasia due to short, irregular ribs, pronounced irregularity of the long bones, and long digits. Short stature is usually present. Intelligence is unimpaired.28 Our patients exhibited all these phenotypical features typical for MNS (figure 2 and online supplementary figure S1). Overall, seven mutations in FLNA have been identified in MNS.8 ,28 ,29 The vast majority (>90%) of individuals have mutations in exon 22, with the two preponderant mutations being p.Ala1188Thr and p.Ser1199Leu. Two reported individuals had exons 7 and 28 mutations.28 The novel p.Gly208Arg substitution we found was located in exon 3, outside the exon 22 MNS cluster, and caused a non-conservative change at a highly evolutionarily conserved residue in the ABD of FLNA, replacing a non-polar-charged amino acid (Gly, G) with a polar-charged one (Arg, R). The Gly208 residue is located in the Calponin Homology 2 domain of the ABD. Missense mutations falling in this domain have also been found in patients with OPD spectrum disorders.8

    Two patients exhibiting a dual phenotype resulting from a single FLNA mutation, acting as both a gain-of-function and loss-of-function had been reported previously. Zenker et al12 described a girl with PNH and FMD, and Hehr et al23 described a boy with PNH, and phenotypical traits reminiscent of the cerebro-fronto-facial syndrome. Considering the above observations, we hypothesised that the dual phenotype observed in our patients, in which MNS and PNH co-occurred, was due to both a gain-of-function (missense) and loss-of-function (splicing alteration) effect of the c.622G>C mutation.

    The nucleotide involved in the c.622G>C mutation is highly conserved and is predicted, in silico, to alter the splicing process (see online supplementary figure S2). This mutation affects the nucleotide upstream the 5′-donor splice site of exon 3, modifying the consensus motif of the donor site.30 Mutations in this site may therefore interfere with the splicing process. To explore this hypothesis at both the mRNA and at the protein level, we performed agarose gel electrophoresis and ultradeep sequencing of the FLNA cDNA obtained from RT-PCR. We also performed FLNA western blot analysis in lymphocyte cells. Gel electrophoresis uncovered an additional fragment in affected individuals, but not in controls (figure 4B). Ultradeep sequencing revealed that this aberrant fragment corresponded to reads that were longer than expected, with a retained intron 3 (figure 4C). Analysis focused on the reads corresponding to the 400 bp fragment revealed that the c.622G>C mutation was present in 3.5%–7.5%. X-inactivation ratios, ranging from 70:30 to 87:13, were closer to those observed in PNH rather than in MNS in which markedly skewed ratios are usually present.8 Ultradeep sequencing results demonstrated the percentage of the transcript carrying the missense substitution (3.5%–7.5%) to be similar to that observed in patients with MNS, in whom such a low percentage could be attributed to an extremely skewed X-inactivation.8 The treatment with cycloheximide of lymphocytes demonstrated that in our patients, the aberrant mRNA transcript retaining intron 3 is subjected to NMD (see online supplementary figure S3).31 Western blot analysis in all affected individuals revealed reduced FLNA levels, as expected, as a consequence of NMD (figure 5). Therefore, in spite of different underlying molecular mechanisms, random X-inactivation plus NMD of the aberrant transcript in our patients, and extremely skewed X-inactivation in patients with isolated MNS, the final amount of transcript carrying the missense substitution was similar.

    Overall, the observation of an additional fragment arising from intron 3 retention, proven to be subjected to NMD, coupled with the low percentages of allele coding for the p.Gly208Arg substitution, demonstrates that a single mutational event leads to both the missense substitution and the aberrant mRNA splicing. The c.622G>C substitution appears, therefore, to cause an aberrant mRNA splicing, resulting in loss-of-function of FLNA and in the PNH phenotype. The same substitution also leads to a missense mutation likely resulting in gain-of-function and in MNS. Although p.Gly208Arg is not predicted to substantially alter the repeat structure of FLNA, it leads to the substitution of a highly conserved amino acid. Additional functional experiments to explore the in vitro F-actin binding activity, which were out of the scope of the present study, would be needed to explore the predicted gain-of-function effects.

    Co-occurring gain-of-function and loss-of-function provide an exceptional model to explain pathogenetic mechanisms leading to otherwise mutually exclusive allelic phenotypes.

    Acknowledgments

    We gratefully acknowledge the patients for participating in the research.

    References

    1. ↵
      1. Fox JW,
      2. Lamperti ED,
      3. Ekşioğlu YZ,
      4. Hong SE,
      5. Feng Y,
      6. Graham DA,
      7. Scheffer IE,
      8. Dobyns WB,
      9. Hirsch BA,
      10. Radtke RA,
      11. Berkovic SF,
      12. Huttenlocher PR,
      13. Walsh CA
      . Mutations in filamin 1 prevent migration of cerebral cortical neurons in human periventricular heterotopia. Neuron 1998;21:1315–25. doi:10.1016/S0896-6273(00)80651-0
      OpenUrlCrossRefPubMedWeb of Science
    2. ↵
      1. Barkovich AJ,
      2. Guerrini R,
      3. Kuzniecky RI,
      4. Jackson GD,
      5. Dobyns WB
      . A developmental and genetic classification for malformations of cortical development: update 2012. Brain 2012;135:1348–69. doi:10.1093/brain/aws019
      OpenUrlAbstract/FREE Full Text
    3. ↵
      1. Sheen VL,
      2. Dixon PH,
      3. Fox JW,
      4. Hong SE,
      5. Kinton L,
      6. Sisodiya SM,
      7. Duncan JS,
      8. Dubeau F,
      9. Scheffer IE,
      10. Schachter SC,
      11. Wilner A,
      12. Henchy R,
      13. Crino P,
      14. Kamuro K,
      15. DiMario F,
      16. Berg M,
      17. Kuzniecky R,
      18. Cole AJ,
      19. Bromfield E,
      20. Biber M,
      21. Schomer D,
      22. Wheless J,
      23. Silver K,
      24. Mochida GH,
      25. Berkovic SF,
      26. Andermann F,
      27. Andermann E,
      28. Dobyns WB,
      29. Wood NW,
      30. Walsh CA
      . Mutations in the X-linked filamin 1 gene cause periventricular nodular heterotopia in males as well as in females. Hum Mol Genet 2001;10:1775–83. doi:10.1093/hmg/10.17.1775
      OpenUrlAbstract/FREE Full Text
    4. ↵
      1. Parrini E,
      2. Ramazzotti A,
      3. Dobyns WB,
      4. Mei D,
      5. Moro F,
      6. Veggiotti P,
      7. Marini C,
      8. Brilstra EH,
      9. Dalla Bernardina B,
      10. Goodwin L,
      11. Bodell A,
      12. Jones MC,
      13. Nangeroni M,
      14. Palmeri S,
      15. Said E,
      16. Sander JW,
      17. Striano P,
      18. Takahashi Y,
      19. Van Maldergem L,
      20. Leonardi G,
      21. Wright M,
      22. Walsh CA,
      23. Guerrini R
      . Periventricular heterotopia: phenotypic heterogeneity and correlation with Filamin A mutations. Brain 2006;129:1892–906. doi:10.1093/brain/awl125
      OpenUrlAbstract/FREE Full Text
    5. ↵
      1. de Wit MC,
      2. de Coo IF,
      3. Lequin MH,
      4. Halley DJ,
      5. Roos-Hesselink JW,
      6. Mancini GM
      . Combined cardiological and neurological abnormalities due to filamin A gene mutation. Clin Res Cardiol 2011;100:45–50. doi:10.1007/s00392-010-0206-y
      OpenUrlCrossRefPubMed
    6. ↵
      1. Sheen VL,
      2. Jansen A,
      3. Chen MH,
      4. Parrini E,
      5. Morgan T,
      6. Ravenscroft R,
      7. Ganesh V,
      8. Underwood T,
      9. Wiley J,
      10. Leventer R,
      11. Vaid RR,
      12. Ruiz DE,
      13. Hutchins GM,
      14. Menasha J,
      15. Willner J,
      16. Geng Y,
      17. Gripp KW,
      18. Nicholson L,
      19. Berry-Kravis E,
      20. Bodell A,
      21. Apse K,
      22. Hill RS,
      23. Dubeau F,
      24. Andermann F,
      25. Barkovich J,
      26. Andermann E,
      27. Shugart YY,
      28. Thomas P,
      29. Viri M,
      30. Veggiotti P,
      31. Robertson S,
      32. Guerrini R,
      33. Walsh CA
      . Filamin A mutations cause periventricular heterotopia with Ehlers-Danlos syndrome. Neurology 2005;64:254–62. doi:10.1212/01.WNL.0000149512.79621.DF
      OpenUrlCrossRefPubMed
    7. ↵
      1. de Wit MC,
      2. Tiddens HA,
      3. de Coo IF,
      4. Mancini GM
      . Lung disease in FLNA mutation: confirmatory report. Eur J Med Genet 2011;54:299–300. doi:10.1016/j.ejmg.2010.12.009
      OpenUrlCrossRefPubMed
    8. ↵
      1. Robertson SP,
      2. Twigg SR,
      3. Sutherland-Smith AJ,
      4. Biancalana V,
      5. Gorlin RJ,
      6. Horn D,
      7. Kenwrick SJ,
      8. Kim CA,
      9. Morava E,
      10. Newbury-Ecob R,
      11. Orstavik KH,
      12. Quarrell OW,
      13. Schwartz CE,
      14. Shears DJ,
      15. Suri M,
      16. Kendrick-Jones J,
      17. Wilkie AO
      ; OPD-spectrum Disorders Clinical Collaborative Group. Localized mutations in the gene encoding the cytoskeletal protein filamin A cause diverse malformations in humans. Nat Genet 2003;33:487–91. doi:10.1038/ng1119
      OpenUrlCrossRefPubMedWeb of Science
    9. ↵
      1. Sun Y,
      2. Almomani R,
      3. Aten E,
      4. Celli J,
      5. van der Heijden J,
      6. Venselaar H,
      7. Robertson SP,
      8. Baroncini A,
      9. Franco B,
      10. Basel-Vanagaite L,
      11. Horii E,
      12. Drut R,
      13. Ariyurek Y,
      14. den Dunnen JT,
      15. Breuning MH
      . Terminal osseous dysplasia is caused by a single recurrent mutation in the FLNA gene. Am J Hum Genet 2010;87:146–53. doi:10.1016/j.ajhg.2010.06.008
      OpenUrlCrossRefPubMedWeb of Science
    10. ↵
      1. Unger S,
      2. Mainberger A,
      3. Spitz C,
      4. Bahr A,
      5. Zeschnigk C,
      6. Zabel B,
      7. Superti-Furga A,
      8. Morris-Rosendahl DJ
      . Filamin A mutation is one cause of FG syndrome. Am J Med Genet Part A 2007;143A:1876–9. doi:10.1002/ajmg.a.31751
      OpenUrl
    11. ↵
      1. Robertson SP
      . Otopalatodigital syndrome spectrum disorders: otopalatodigital syndrome types 1 and 2, frontometaphyseal dysplasia and Melnick-Needles syndrome. Eur J Hum Genet 2007;15:3–9. doi:10.1038/sj.ejhg.5201654
      OpenUrlCrossRefPubMed
    12. ↵
      1. Zenker M,
      2. Rauch A,
      3. Winterpacht A,
      4. Tagariello A,
      5. Kraus C,
      6. Rupprecht T,
      7. Sticht H,
      8. Reis A
      . A dual phenotype of periventricular nodular heterotopia and frontometaphyseal dysplasia in one patient caused by a single FLNA mutation leading to two functionally different aberrant transcripts. Am J Hum Genet 2004;74:731–7. doi:10.1086/383094
      OpenUrlCrossRefPubMedWeb of Science
    13. ↵
      1. Mei D,
      2. Marini C,
      3. Novara F,
      4. Bernardina BD,
      5. Granata T,
      6. Fontana E,
      7. Parrini E,
      8. Ferrari AR,
      9. Murgia A,
      10. Zuffardi O,
      11. Guerrini R
      . Xp22.3 genomic deletions involving the CDKL5 gene in girls with early onset epileptic encephalopathy. Epilepsia 2010;51:647–54. doi:10.1111/j.1528-1167.2009.02308.x
      OpenUrlCrossRefPubMed
    14. ↵
      1. Kuo PL,
      2. Huang SC,
      3. Chang LW,
      4. Lin CH,
      5. Tsai WH,
      6. Teng YN
      . Association of extremely skewed X-chromosome inactivation with Taiwanese women presenting with recurrent pregnancy loss. J Formos Med Assoc 2008;107:340–3. doi:10.1016/S0929-6646(08)60096-0
      OpenUrlCrossRefPubMedWeb of Science
    15. ↵
      1. Usuki F,
      2. Yamashita A,
      3. Higuchi I,
      4. Ohnishi T,
      5. Shiraishi T,
      6. Osame M,
      7. Ohno S
      . Inhibition of nonsense-mediated mRNA decay rescues the phenotype in Ullrich's disease. Ann Neurol 2004;55:740–4. doi:10.1002/ana.20107
      OpenUrlCrossRefPubMedWeb of Science
    16. ↵
      1. Ohta Y,
      2. Hartwig JH
      . Actin filament cross-linking by chicken gizzard filamin is regulated by phosphorylation in vitro. Biochemistry 1995;34:6745–54. doi:10.1021/bi00020a020
      OpenUrlCrossRefPubMedWeb of Science
    17. ↵
      1. Gardel ML,
      2. Nakamura F,
      3. Hartwig JH,
      4. Crocker JC,
      5. Stossel TP,
      6. Weitz DA
      . Prestressed F-actin networks cross-linked by hinged filamins replicate mechanical properties of cells. Proc Natl Acad Sci USA 2006;103:1762–7. doi:10.1073/pnas.0504777103
      OpenUrlAbstract/FREE Full Text
    18. ↵
      1. Stossel TP,
      2. Condeelis J,
      3. Cooley L,
      4. Hartwig JH,
      5. Noegel A,
      6. Schleicher M,
      7. Shapiro SS
      . Filamins as integrators of cell mechanics and signalling. Nat Rev Mol Cell Biol 2001;2:138–345. doi:10.1038/35052082
      OpenUrlCrossRefPubMedWeb of Science
    19. ↵
      1. Guerrini R,
      2. Mei D,
      3. Sisodiya S,
      4. Sicca F,
      5. Harding B,
      6. Takahashi Y,
      7. Dorn T,
      8. Yoshida A,
      9. Campistol J,
      10. Krämer G,
      11. Moro F,
      12. Dobyns WB,
      13. Parrini E
      . Germline and mosaic mutations of FLN1 in men with periventricular heterotopia. Neurology 2004;63:51–6. doi:10.1212/01.WNL.0000132818.84827.4D
      OpenUrlCrossRef
    20. ↵
      1. Solé G,
      2. Coupry I,
      3. Rooryck C,
      4. Guérineau E,
      5. Martins F,
      6. Devés S,
      7. Hubert C,
      8. Souakri N,
      9. Boute O,
      10. Marchal C,
      11. Faivre L,
      12. Landré E,
      13. Debruxelles S,
      14. Dieux-Coeslier A,
      15. Boulay C,
      16. Chassagnon S,
      17. Michel V,
      18. Routon MC,
      19. Toutain A,
      20. Philip N,
      21. Lacombe D,
      22. Villard L,
      23. Arveiler B,
      24. Goizet C
      . Bilateral periventricular nodular heterotopia in France: frequency of mutations in FLNA, phenotypic heterogeneity and spectrum of mutations. J Neurol Neurosurg Psychiatry 2009;80:1394–98. doi:10.1136/jnnp.2008.162263
      OpenUrlAbstract/FREE Full Text
    21. ↵
      1. Parrini E,
      2. Rivas IL,
      3. Toral JF,
      4. Pucatti D,
      5. Giglio S,
      6. Mei D,
      7. Guerrini R
      . In-frame deletion in FLNA causing familial periventricular heterotopia with skeletal dysplasia in males. Am J Med Genet Part A 2011;155A:1140–6. doi:10.1002/ajmg.a.33880
      OpenUrlCrossRef
    22. ↵
      1. Oegema R,
      2. Hulst JM,
      3. Theuns-Valks SD,
      4. van Unen LM,
      5. Schot R,
      6. Mancini GM,
      7. Schipper ME,
      8. de Wit MC,
      9. Sibbles BJ,
      10. de Coo IF,
      11. Nanninga V,
      12. Hofstra RM,
      13. Halley DJ,
      14. Brooks AS
      . Novel no-stop FLNA mutation causes multi-organ involvement in males. Am J Med Genet A 2013;161:2376–84. doi:10.1002/ajmg.a.36109
      OpenUrlCrossRef
    23. ↵
      1. Hehr U,
      2. Hehr A,
      3. Uyanik G,
      4. Phelan E,
      5. Winkler J,
      6. Reardon W
      . A filamin A splice mutation resulting in a syndrome of facial dysmorphism, periventricular nodular heterotopia, and severe constipation reminiscent of cerebro-fronto-facial syndrome. J Med Genet 2006;43:541–4. doi:10.1136/jmg.2005.038505
      OpenUrlAbstract/FREE Full Text
    24. ↵
      1. Feng Y,
      2. Walsh CA
      . The many faces of filamin: a versatile molecular scaffold for cell motility and signalling. Nat Cell Biol 2004;6:1034–8. doi:10.1038/ncb1104-1034
      OpenUrlCrossRefPubMedWeb of Science
    25. ↵
      1. Guerrini R,
      2. Dobyns WB
      . Malformations of cortical development: clinical features and genetic causes. Lancet Neurol 2014;13:710–26. doi:10.1016/S1474-4422(14)70040-7
      OpenUrlCrossRefPubMed
    26. ↵
      1. Jamuar SS,
      2. Lam AT,
      3. Kircher M,
      4. D'Gama AM,
      5. Wang J,
      6. Barry BJ,
      7. Zhang X,
      8. Hill RS,
      9. Partlow JN,
      10. Rozzo A,
      11. Servattalab S,
      12. Mehta BK,
      13. Topcu M,
      14. Amrom D,
      15. Andermann E,
      16. Dan B,
      17. Parrini E,
      18. Guerrini R,
      19. Scheffer IE,
      20. Berkovic SF,
      21. Leventer RJ,
      22. Shen Y,
      23. Wu BL,
      24. Barkovich AJ,
      25. Sahin M,
      26. Chang BS,
      27. Bamshad M,
      28. Nickerson DA,
      29. Shendure J,
      30. Poduri A,
      31. Yu TW,
      32. Walsh CA
      . Somatic mutations in cerebral cortical malformations. N Engl J Med 2014;371:733–43. doi:10.1056/NEJMoa1314432
      OpenUrlCrossRefPubMed
    27. ↵
      1. Clark AR,
      2. Sawyer GM,
      3. Robertson SP,
      4. Sutherland-Smith AJ
      . Skeletal dysplasias due to filamin A mutations result from a gain-of-function mechanism distinct from allelic neurological disorders. Hum Mol Genet 2009;18:4791–800. doi:10.1093/hmg/ddp442
      OpenUrlAbstract/FREE Full Text
    28. ↵
      1. Foley C,
      2. Roberts K,
      3. Tchrakian N,
      4. Morgan T,
      5. Fryer A,
      6. Robertson SP,
      7. Tubridy N
      . Expansion of the spectrum of FLNA mutations associated with Melnick-Needles syndrome. Mol Syndromol 2010;1:121–6. doi:10.1159/000320184
      OpenUrlCrossRefPubMed
    29. ↵
      1. Santos HH,
      2. Garcia PP,
      3. Pereira L,
      4. Leão LL,
      5. Aguiar RA,
      6. Lana AM,
      7. Carvalho MR,
      8. Aguiar MJ
      . Mutational analysis of two boys with the severe perinatally lethal Melnick-Needles syndrome. Am J Med Genet A 2010;152A:726–31. doi:10.1002/ajmg.a.33260
      OpenUrl
    30. ↵
      1. Baralle D,
      2. Baralle M
      . Splicing in action: assessing disease causing sequence changes. J Med Genet 2005;42:737–48. doi:10.1136/jmg.2004.029538
      OpenUrlAbstract/FREE Full Text
    31. ↵
      1. Holbrook JA,
      2. Neu-Yilik G,
      3. Hentze MW,
      4. Kulozik AE
      . Nonsense-mediated decay approaches the clinic. Nat Genet 2004;36:801–8. doi:10.1038/ng1403
      OpenUrlCrossRefPubMedWeb of Science

    Supplementary materials

    • Supplementary Data

      This web only file has been produced by the BMJ Publishing Group from an electronic file supplied by the author(s) and has not been edited for content.

      Files in this Data Supplement:

    Footnotes

    • Contributors DP performed FLNA mutation analysis; SC and AM designed and performed western blot analysis; CB performed RT-PCR analysis; DM designed and performed ultradeep sequencing analysis and helped write the manuscript; MLC, MAP and EB identified and clinically characterised the family; MM radiologically characterised the family; EP and RG organised clinical information and experiments, directed the overall research, and wrote the manuscript.

    • Funding This work was supported by a grant from the European Union Seventh Framework Programme FP7/2007–2013 under the project DESIRE (grant agreement no. 602531) and the European Research Projects on Rare Diseases (E-Rare-2, TUB-GENCODEV, 11-027).

    • Competing interests None.

    • Patient consent Obtained.

    • Ethics approval Institutional Review Board of the Meyer Children's Hospital, Florence, Italy.

    • Provenance and peer review Not commissioned; externally peer reviewed.