Article Text

Short report
A human laterality disorder associated with recessive CCDC11 mutation
  1. Zeev Perles1,
  2. Yuval Cinnamon2,
  3. Asaf Ta-Shma3,
  4. Avraham Shaag2,
  5. Tom Einbinder3,
  6. Azaria J J T Rein1,
  7. Orly Elpeleg2
  1. 1Department of Pediatric Cardiology, Hadassah-Hebrew University Medical Center, Jerusalem, Israel
  2. 2Monique and Jacques Roboh Department of Genetic Research, Hadassah-Hebrew University Medical Center, Jerusalem, Israel
  3. 3Department of Pediatrics, Hadassah-Hebrew University Medical Center, Jerusalem, Israel
  1. Correspondence to Professor Orly Elpeleg, Hadassah-Hebrew University Medical Centre, Jerusalem 91120, Israel; elpeleg{at}hadassah.org.il

Abstract

Background Significant advancements in understanding the molecular pathophysiology of laterality determination were recently made. However, there are large gaps in our knowledge of the initial processes that lead to laterality defects, such as heterotaxy syndrome (HS, also known as situs ambiguous) and situs inversus totalis (SIT). The former refers to abnormal distribution of visceral organs, and the latter refers to a complete laterality inversion of both abdominal and thoracic viscera.

Methods In order to identify a mutated gene in SIT and HS patients, the authors performed homozygosity mapping in a consanguineous family with laterality disorders identified in two siblings.

Results A homozygous deleterious mutation in the CCDC11 gene was identified in the patients. The mutation resulted in an abnormally smaller protein in the patient's skin fibroblasts. The parents and five healthy siblings were heterozygous for the mutation, which was not present in 112 anonymous controls.

Conclusions Few genes have been associated with both SIT and HS, usually accompanied by other abnormalities. The authors suggest that CCDC11 is associated with autosomal recessive laterality defects of diverse phenotype resulting in SIT in one individual family member who is otherwise healthy, and in complex laterality anomalies (HS) in another member. This report underscores the importance of CCDC11 in laterality determination.

  • Cilia
  • situs inversus totalis
  • heterotaxy
  • CCDC11
  • homozygousity mapping
  • developmental
  • congenital heart disease
  • cardiovascular medicine
  • cardiomyopathy
  • genetics
  • neuromuscular disease
  • molecular genetics
View Full Text

Statistics from Altmetric.com

Introduction

The orthogonal axes of the mammalian body are determined during the early stages of embryogenesis. While proper patterning of anterior-posterior and dorso-ventral axes is obligatory for survival, flaws in left-right (L-R) asymmetry are occasionally viable. All vertebrates exhibit visceral L-R axis asymmetry.1 A failure to generate normal asymmetry, or situs solitus, may result in several morphological anomalies, among them are heterotaxy syndrome (HS) and the situs inversus totalis (SIT).2

HS (also called situs ambiguous) is abnormal L-R axis arrangement of the abdominal and/or thoracic viscera involving organs, which normally develop on one side; for example, the spleen may appear on both sides, resulting in polysplenia, or on neither side, leading to asplenia. HS is almost always accompanied by complex congenital heart disease.3 4

SIT is a mirror-image asymmetry of the internal abdominal and thoracic viscera and is frequently associated with Kartagener's syndrome or primary ciliary dyskinesia 1 (PCD1, OMIM # 24440).5 Much less frequently, it is associated with other pathological conditions, such as autosomal-dominant polycystic kidney disease.6 In rare situations, SIT may occur as an isolated anomaly with an otherwise normal anatomy and function of organs.

The surprising finding that three out of four patients with sperm immotility and chronic sinusitis also had SIT, led Afzelius7 to propose that visceral asymmetry is determined through embryonic ciliary motion. It was later found that the nodal cilia indeed play a pivotal role in L-R asymmetry patterning.8 Several PCD-causing genes that are responsible for ciliary-beat generation are known, mostly encoding dynein arm components, such as DNAI1 and DNAH5.9 The list of mutated genes that cause L-R asymmetry defects not associated with PCD, is much shorter. We now report on the identification of a new candidate gene in L-R asymmetry determination.

Results and discussion

Patient 2541 was the third child to consanguineous Arab-Muslim parents (figure 1A). At 14 years of age, he was admitted to our tertiary facility due to a congenital heart disease with worsening cyanosis and fatigue on minimal exertion. On examination, he had digital clubbing, 4/6 systolic ejection murmur over the left upper sternal border and oxygen saturation was 65% in room air. Echocardiography revealed a complex congenital cardiovascular defect and abdominal situs anomalies as described in figure 1B,C. The patient underwent bidirectional superior cavopulmonary connection (Glenn procedure), but the postoperative course was complicated by deep vein thrombosis and cerebrovascular infarct which led to his death. Physical examination, echocardiography and abdominal ultrasound of his parents and six siblings revealed an asymptomatic, healthy 17-year-old brother (2535) with SIT with an otherwise normal cardiac anatomy and function (figure 1A). Both situs inversus and HS are often associated with PCD. However, the two siblings, 2541 and 2535 described above, presented with dramatic clinical variance. While patient 2541 was severely affected, his brother 2535 was apparently healthy. In order to investigate a potential PCD in the allegedly healthy brother, we analysed his respiratory and sperm cilia. Consistent with the lack of any respiratory symptoms, qualitative light microscopy examination of his nasal-brushing sample revealed beating ciliated cells. This was complemented by electron microscopy examination of the sample, which demonstrated normal ciliary ultrastructure with typical 9:2 doublet microtubules, nexin links, radial spokes and inner and outer dynein arms10 (online supplementary figure 2).

Figure 1

(A) The family pedigree and the haplotypes around the critical region on chromosome 18. The markers used, and their genomic localisation in Mb (HG18), are given in the upper right side box. For marker D18S450, allele A represents 223 bp and allele B225 bp. The haplotypes of individuals 2540, 2536, 2835 and 2539 were identical to that of 2537. (B) Chest x-ray of patient 2541 showing situs malformation. The cardiac apex is to the left and the stomach bubble is on the right. Additionally, abdominal ultrasound examination revealed midline liver and inverted stomach and spleen (not shown). (C) Schematic diagram of the heart structure in B, showing complete unbalanced atrioventricular canal defect with single atrium and common atrioventricular valve, hypoplastic left ventricle with bulboventricular foramen, double outlet right ventricle with transposition of the great arteries with severe pulmonary stenosis, right aortic arch, abnormal systemic venous return and total anomalous pulmonary venous drainage. In addition, a single left coronary artery was demonstrated by an angiographic contrast injection (not shown). RV, right ventricle; LV, left ventricle; Ao, aorta; PA, pulmonary artery; PV, pulmonary vein; IVC, inferior vena cava; SVC, superior vena cava.

Furthermore, in an ejaculation volume of 2.6 ml (normal level >1.5 ml), the sperm count was 34 million/ml (normal level >15 million/ml) with normal sperm motility in 71% (normal >40%), and normal structure in 21% (normal level >8%) of the sperm, indicating a normal content and function of the motile cilia in patient 2535.

In order to identify the mutated gene in this family, we searched for shared homozygous regions in DNA samples of the two patients using the Affymetrix GeneChip Human Mapping 250K Nsp Array, as previously described.11 Informed consent was granted by the parents, and all experiments involving biological material of the patients, their relatives and anonymous controls were approved by the Hadassah Helsinki Committee and the Ministry of Health. The analysis resulted in the identification of five homozygous regions larger than 2 Mb (online supplementary table 1). Using short tandem repeat and single nucleotide polymorphism markers in DNA samples of the parents, the patients and the unaffected siblings 2835, 2536 and 2537, four regions were excluded leaving a single critical region of 4.4 Mb on chromosome 18 (online supplementary figure 1). Within this region, there were 18 protein-coding genes, and after prioritisation based on interaction with genes known to be involved with laterality disorders using GeneDistiller software,12 and on the ciliary proteome database,13 we determined the sequence of the coding exons of the five top candidate genes on our list (online supplementary figure 1). No mutation was detected in SMAD4, MYO5B, SMAD7 and DCC. In the fifth gene, CCDC11, which was selected because of its preferential expression in ciliated cells,14 a homozygous splice-site mutation, c. 1213 +1 G to A (chr18:46023267 in HG18), affecting the first nucleotide of intron 6 was identified in the patients (figure 2A–C). The mutation was not present in dbSNP 135 or on the Exome Variant Server of NHLBI Exome Sequencing Project, and was predicted by MutationTaster software15 to be disease-causing at a probability of 0.999. The parents and the five healthy siblings were heterozygous for the mutation. Moreover, the mutation was not carried by any of the 112 anonymous control samples of the same ethnic origin. We searched among patients with SIT or HS who originated from nine consanguineous families, but none had a chromosome 18 homozygous region encompassing the CCDC11 gene.

Figure 2

The c. 1213 +1 G to A mutation (arrow) in the CCDC11 gene in patient 2535 (A), the mother (B) and a control sample (C). The 3′-end of exon 6 is marked, (D). cDNA of patient 2535 demonstrating exon 6 skipping. Exon 5 is marked followed by exon 7. (E) Translation of the cDNA region shown in (D). Following exon 5, exon 7 is inserted out-of-frame resulting in a translation of 17 non-synonymous amino acids and stop codon (marked). The correct translation of exon 7 is encoded by the ORF +3 is indicated. (F) RT-PCR targeted to exons 4–8, showing a ∼200bp shorter ccdc11 transcript in patient 2535 which corresponds to the skipping of exon 6 (Exon 6 contains 217 bp). This skipping was confirmed by sequencing as shown in (D). Note that following 30 cycles, the WT transcript is undetectable in patient's sample. (G) Western blot analysis with anti CCDC11 antibody of total protein extracted from skin fibroblasts of control and patient 2535. While in the control sample a normal size protein is detected at ∼60 kD, a shorter truncated form at ∼35 kD is evident in patient 2535 protein extracts. Anti-αTubulin blot confirms a comparable loading.

CCDC11 consists of eight exons that encode 514 amino acid proteins. In order to elucidate the consequences of the mutation, we generated cDNA from the skin fibroblasts of patient 2535. Sequencing the CCDC11 transcript demonstrated a skipping of exon 6, which leads to a frameshift after exon 5, resulting in an insertion of 17 non-synonymous amino acids before reaching a stop codon (figure 2D,E). Following 30 cycles of reverse transcriptase PCR, no WT transcripts were detected (figure 2F). Containing 349 amino acids, the truncated protein-predicted size is ∼35 kDa losing a partly evolutionary-conserved coiled-coil domain. Western blot analysis of total protein extracted from skin fibroblasts of control and patient 2535 revealed a ∼60 kDa band in the control samples and a smaller band, ∼35 kDa, in the patient's cells. The same membranes which were used for the anti-CCDC11 antibody were re-probed with anti α-tubulin antibody to confirm that a comparable amount of total protein extract was loaded in all lanes (figure 2G).

The chirality that gives rise to the vertebrate asymmetric L-R patterning occurs during early embryogenesis. HS and SIT are disorders thought to be caused by an abnormal initial break of symmetry. While incidental finding of asymptomatic individuals with laterality disorders is infrequent, SIT with apparently normal ciliogenesis and normal ciliary functions is an extremely rare phenomenon.

The breakage of the embryonic bilateral symmetry is thought to be coordinated by nodal cilia, which create leftward flow8 and asymmetric distribution of the morphogene Nodal at the node. The flow initiates the onset of an asymmetric downstream signalling, the Nodal signalling pathway, which in turn activates an asymmetric developmental programme within the lateral plate mesoderm.16–18 Other models suggest that mechanosensory cilia within the node initiate a calcium-mediated signal transduction in response to asymmetric mechanical pressure of fluid flow generated by motile cilia. This event leads to the asymmetric induction of Nodal pathway and other left-sided genes.19 20 Nodal cilia share many structural features with other motile cilia, and impaired function of the nodal cilia is likely an integral part of PCD; however, due to randomisation of L-R axis development, it is clinically manifested in only half the PCD patients.9 Notably, CCDC11 mRNA was shown to be overexpressed in human bronchial epithelial cells undergoing mucociliary differentiation,21 and to be expressed in epidermal ciliated cells in Xenopus laevis embryos undergoing neurulation14 suggesting a role in ciliogenesis or ciliary function. However, the fact that our patients had no respiratory complaints, but had normal beating nasal cilia, intact axonemal ultrastructure and normal sperm motility may stand in disagreement with this assumption. However, it is possible that although CCDC11 is expressed in other ciliated cells, it is exclusively required at the node, whereas a redundant mechanism that compensates for its absence exists during later developmental stages and in adulthood.

Several genes have been implicated in isolated laterality defects in humans, the major being the X-linked transcription factor, ZIC3, which participates in asymmetry patterning; mutations in this gene account for ∼1% of heterotaxy patients22 and was recently shown to be involved in SIT.23 Other genes affecting the signal transduction of L-R asymmetry are the transforming growth factor β family member Nodal in which mutations account for ∼5% of HS patients,24 the Activin receptor, ACVR2B,25 and CFC1.26 These proteins are involved in isomerism probably via complex interactions with the Nodal signalling pathway.27 SIT/PCD1 and HS are usually discussed as two distinctive syndromes; however, certain overlap exists between them: 6.3% of the PCD1 patients have HS and respiratory complications. Moreover, the rate of these complications among postoperative HS patients is higher than expected, suggesting an underlying ciliary dysfunction.28 In agreement, among PCD patients with CCDC39 mutations, 41% had SIT and 14% had HS.29 Thus, our finding of HS and SIT in the same family is likely to be caused by the same flaw in an L-R axis-determining gene.

At this stage, it is still unclear whether CCDC11 plays a role in ciliogenesis or in the signalling pathway, which leads to the break of the embryonic bilateral symmetry; clearly, these processes are not mutually exclusive. There are over 169 CCDC family members, which share a coiled-coil domain, notably, it is one of the most abundant motifs in nature, often involved in protein-protein interactions. No other similarities between the CCDC family members have been described; however, several CCDC members were found in the cilia proteome (CCDC2, CCDC6, CCDC12, CCDC13, CCDC19 and CCDC22), and few were recently found to be associated with cilia and ciliopathies, such as CCDC3929 CCDC40,30 CCDC65,31 CCDC10032 and CCDC135.33 Other CCDC family members were found to partake in signalling pathways involved in embryonic development, such as CCDC88c in the Wnt pathway,34 CCDC50 in the epidermal growth factor pathway,35 CCDC106 in the p53 pathway36 and CCDC26 in the retinoic acid pathway.37 Taken together, CCDC family members have critical roles in a wide variety of biological processes making it hard to predict the specific roles of CCDC11 in L-R asymmetric patterning.

We conclude that a deleterious mutation in the CCDC11 gene, which results in an abnormally smaller protein is associated with impaired L-R asymmetry manifested by HS with complex heart malformation and in SIT. The lack of clinical symptoms, and the normal appearance and function of other motile cilia, suggest that CCDC11 product is required either exclusively for nodal cilia function or for downstream signal transduction. Further study of additional patients and disease models will be required to substantiate the roles of CCDC11 in axial patterning and laterality defects.

Materials and methods

Genomic and transcription analysis

Total RNA was extracted from skin fibroblasts using TRI reagent (Sigma, Israel) and reverse-transcribed to generate cDNA using ImProm-II TM Reverse Transcription System (Promega, USA) according to the manufacturer's instructions. Forward primer (ACAGCTGCTGAAGGAAGAGG) targeted to the fourth exon and reverse primer (ACTCCTGGGCTAAACGTTGG) targeted to the eighth exon were used for PCR. The WT transcript-predicted size is 595 bp. Exon 6 contains 217 bp, thus the predicted size of the mutated transcript (excluding exon 6) is 378 bp. The PCR product was directly sequenced and the skipping of exon 6 was confirmed. Applied Biosystems 3130xl Genetic Analyser was used for sequencing according to the manufacturer's instructions.

Western blot analysis

Total protein from skin fibroblasts was extracted using radioimmunoprecipitation assay buffer (150 mM NaCl, 10 mM Tris, pH 7.2, 0.1% sodium dodecyl sulphate, 1.0% Triton X-100, 1% Na-Deoxycholate, 5 mM EDTA) supplement with protease inhibitors cocktail (Sigma, Israel). Protein concentration was measured using Bradford assay (Sigma, Israel). 30 ug of total protein extracts were loaded on 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane. Rabbit anti-human CCDC11 antibody (Abcam, Cambridge, UK) was diluted to a final concentration of 1 ug/ml. CCDC11 immunising peptide (ab117880, Abcam Cambridge, UK), which corresponds to the 2–51 amino acids (YSQRFGTVQR EVKGPTPKVV IVRSKPPKGQ GAEHHLERIR RSHQKHNAIL), at a final concentration of 0.25 ug/ml, and 1 ug/ml was used to validate the specificity of the antibody according to the manufacturer's protocol (Abcam, Cambridge, UK).

Electron microscopy analysis

Nasal brush biopsy was taken from the middle turbinate and fixed in 4% formaldehyde and 1% glutaraldehyde in 100 mM phosphate buffer at 4°C, washed overnight and postfixed in 1% (w/v) osmium tetroxide. After dehydration, samples were embedded in a propylene oxide/epoxy resin mixture. Following polymerisation, several resin sections were cut using an ultramicrotome. The sections were picked up onto copper grids and stained with Reynold's lead citrate. Transmission electron microscopy was performed with a (JEOL, USA).

Acknowledgments

The excellent technical assistance of Lital Sheva, Vivi Tzur and Naama Lanxner is greatly appreciated. The authors thank Dr Zvi Neeman for assisting with the electron microscopy analysis. YC acknowledges the support of the Human Frontier Science Program.

References

View Abstract

Supplementary materials

Footnotes

  • ZP and YC contributed equally to this work.

  • Competing interests None.

  • Patient consent The parents signed the Hadassah consent form, translated to Arabic.

  • Ethics approval Ethics approval was provided by the Hadassah Helsinki committee.

  • Provenance and peer review Not commissioned; externally peer reviewed.

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.