Article Text

Download PDFPDF

Novel CENPJ mutation causes Seckel syndrome
  1. Mohammed S Al-Dosari1,2,
  2. Ranad Shaheen1,
  3. Dilek Colak3,
  4. Fowzan S Alkuraya1,4,5
  1. 1Department of Genetics, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia
  2. 2Department of Pharmacognosy, College of Pharmacy, King Saud University, Riyadh, Saudi Arabia
  3. 3Department of Biostatistics, Epidemiology and Scientific Computing, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia
  4. 4Department of Pediatrics, King Khalid University Hospital and College of Medicine, King Saud University, Riyadh, Saudi Arabia
  5. 5Department of Anatomy and Cell Biology, College of Medicine, Alfaisal University, Riyadh, Saudi Arabia
  1. Correspondence to Fowzan S Alkuraya, Developmental Genetics Unit, Department of Genetics, King Faisal Specialist Hospital and Research Center, MBC 03, PO Box 3354, Riyadh 11211, Saudi Arabia; falkuraya{at}kfshrc.edu.sa

Abstract

Background Primordial dwarfism (PD) is an extremely rare, clinicallyheterogeneous condition characterised by profound prenatal and postnatal growth restriction among other manifestations that are helpful in the clinical classification. Recently, mutation of PCNT was reported in the context of two overlapping forms of PD: Seckel syndrome and Majewskiosteodysplastic primordial dwarfism type II (MOPDII).

Aim To clinically and molecularly characterise a consanguineous family with Seckel syndrome.

Methods Clinical evaluation, linkage analysis, homozygosity mapping and mutation analysis.

Results Unexpectedly, linkage analysis led to the identification of a novel splice-site mutation in CENPJ that segregates with the phenotype in this family.

Conclusion This report establishes for the first time that mutation of CENPJ can lead to Seckel syndrome and calls for further investigation of the role played by other microcephaly related genes in the pathogenesis of PD.

  • Primordial dwarfism
  • aberrant splicing
  • molecular genetics
View Full Text

Statistics from Altmetric.com

Introduction

Half a century ago, Seckel reported on two patients with profound proportionate prenatal and postnatal growth restriction and reviewed an additional 13 cases from the literature.1 These patients also had in common severe microcephaly, bird-like facies, mental retardation and some other anomalies such as dislocation of the head of the radius. This syndrome of primordial dwarfism (PD) was termed Seckel syndrome and was later found to be more clinically heterogeneous than previously thought; different syndromes with significant overlap, albeit distinct radiologically, have since been described.2 In particular, Majewski osteodysplastic primordial dwarfism type II (MOPDII) can only be differentiated from the ‘classical’ Seckel syndrome on the basis of distinct radiographic findings and lack of mental retardation.3 Recently, mutations of PCNT were found to cause PD; while both Seckel syndrome and MOPDII phenotypes were included in the initial reports, many believe that all PCNT mutation positive patients should be classified as MOPDII, although the significant overlap between the two conditions is acknowledged.4–6

We report on an extended consanguineous family with clinical features of Seckel syndrome in which a novel mutation in CENPJ, a gene that has hitherto been linked to primary microcephaly only, was identified.

Subjects and methods

Patients

Patients were evaluated at the clinical genetics unit and an informed written consent was obtained from the patients and their relatives (KFSHRC IRB Protocol 208006).

DNA and RNA extractions

DNA and RNA were extracted from whole blood using the Gentra DNA Extraction Kit (Valencia, California, USA) and Qiagen RNeasy Mini Kit (Valencia, California, USA), respectively, following the manufacturer's instructions.

Genotyping

DNA samples were processed on the Affymetrix Gene Chip Human Mapping 250K array (Santa Clara, California, USA) following the manufacturer's instructions.

Homozygosity mapping and linkage analysis

SNP genotypes were analysed for linkage analysis and homozygosity mapping using EasyLinkage (V5.08) software and CNAG (V2.0), respectively.7 8

Mutation analysis

The entire coding region, exon–intron boundaries of CENPJ and PCNT were PCR amplified. Sequencing was performed by dye termination sequencing using BigDye Terminator Cycle Sequencing V3.1 Kit and Prism 370XL Genetic Analyzer (Applied Biosystems, Foster City, California, USA). DNA sequences were analysed using the Seqman program of the DNASTAR analysis package (Lasergene, Madison, Wisconsin, USA).

Reverse transcription

The cDNA of CENPJ was obtained from the extracted RNA via Qiagen Omniscript RT Kit using TGGAAGAGAGCAGAAGCCATA (forward, exon 10) and TTCGAGTTCCATTGGGAAAC (reverse, exon 14) primers, following the manufacturer's instructions. Produced cDNA were extracted from 2% agarose gel using the Qiagen Gel Extraction Kit and then subjected to direct sequencing.

Results

Clinical data

Propositus (patient 1) was referred to us at 4 years of age because of severe failure to thrive. She was born to first cousin parents from Southern Saudi Arabia. Her pregnancy was notable for intrauterine growth retardation (IUGR). At birth, she was noted to be extremely small with a weight of 1.5 kg, length of 39 cm, and head circumference (HC) of 30 cm. Her cognitive and motor development has been normal. At the time of evaluation, we confirmed the severe growth restriction with height of 80 cm (−7SD), weight of 6 kg (−7.3SD), and head circumference of 40.5 cm (−7.5SD). She had a receding chin, high forehead, prominent nasal spine, hypoplastic alae nasi and low set ears (figure 1). Neurological examination was largely normal although she was too shy to engage in a verbal conversation. Karyotype, brain magnetic resonance imaging (MRI) and a skeletal survey revealed normal findings. Although she did not display the phenotype of Russel–Silver syndrome, we did test her for methylation at 11p15, which was normal, and she was negative for UPD7.

Figure 1

Pedigree (upper panel) and clinical pictures (lower panel) of patients with a novel CENPJ mutation and Seckel syndrome. (A) Father (168 cm) is shown alongside patient 1 (4 years) for comparison. Note the prominent and high nasal spine, hooked nose, hypoplastic alae nasi, receding chin and lack of sloping forehead. Three affected cousins (B, C and D) are shown for with comparable craniofacial features (numbers in white correspond to the numbers used in the pedigree and text).

One year later, we evaluated the newborn sister of patient 1 who was born following a term IUGR pregnancy. She clearly has the same condition based on her growth parameters (weight 1.4 kg, length 38.7 cm, head circumference 30.25 cm) and facial features. However, a skeletal survey revealed the presence of 11 ribs and steep acetabular roof. At this point, the parents admitted the presence of several cousins who are ‘dwarfs’. While history was suggestive of normal cognitive and motor development for two of the three cousins (patients 4 and 5, aged 5 and 6 years, respectively), the third cousin (patient 3) clearly had intellectual impairment (IQ 60) and is still in elementary school at the age of 16 years. All three cousins had anthropometric values at least 7SD below the mean, and had strikingly similar facial features (figure 1).

Homozygosity mapping and identification of a CENPJ splicing mutation

CNAG revealed only one block of homozygosity that overlapped between the affected members of this extended family spanning around 4 Mb on 13q12. Similarly, EasyLinkage generated a corresponding peak with a logarithm of odds (LOD) score of 3.4. The locus contains 65 genes including CENPJ. CENPJ sequencing identified a homozygous transition in the last nucleotide of intron 11(IVS11-1G>C). The mutation fully segregated with the phenotype in the family and was not found in 96 Saudi controls. Reverse transcription revealed that this splice junction mutation completely abolishes the consensus splice acceptor site and decreases the efficiency of the two adjacent acceptor sites, leading to the generation of three different transcripts (figure 2 and table 1). The three transcripts had equivalent intensity and were equally represented from among the 20 clones screened, suggesting they were generated at equal amounts.

Figure 2

CENPJ mutation in Seckel syndrome. (A) Sequence chromatogram showing the G→C transition (arrow). (B) Reverse transcriptase polymerase chain reaction (RT-PCR) of the region affected by the mutation (covers exon 10–exon 14) in patient and control. The right hand diagram explains the skipped exons for each aberrant band on the gel (X=skipped). The first lacks exon 12 (65 bp) and results in deletion of 20 amino acids, frame shift, and premature truncation. The second aberrant transcript lacks exons 11 and 12 (150 bp) and results in deletion of 50 amino acids, while the last aberrant transcript lacks exons 11, 12 and 13 (261 bp) and results in deletion of 87 amino acids.

Table 1

List of human mutations in CENPJ

Discussion

Molecular data on PD were only available for Seckel syndrome and were limited to the single report of ATR mutation in a Pakistani family as well as the report of two loci on chromosomes 14q23 and 18p11, respectively.9–11 The reports by Rauch and Griffith suggested PCNT mutations as a cause of PD.5 6 However, there is a growing consensus that PCNT mutations lead to MOPDII instead.4 12 While the clinical phenotype of our patients is consistent with Seckel syndrome, we did exclude PCNT by direct sequencing in view of the overlap between the two syndromes. We then hypothesised that this family harbours a mutation in a novel Seckel syndrome gene. Indeed, a genome wide homozygosity scan and linkage analysis identified a novel locus on 13q12.11–12.13 spanning about 4 Mb. The locus contained more than 60 genes including CENPJ. Sequence analysis of CENPJ in our family revealed the presence of a homozygous splice acceptor mutation in the last nucleotide of intron 11. While this mutation is expected to cause skipping of exon 12 during transcription, which we confirmed experimentally, two more transcripts were also produced: one that lacks exons 11 and 12, and another that lacks exons 11, 12, and 13. This may represent a cellular attempt to salvage this important protein since these two transcripts would result in in-frame deletion and preservation of the C-terminus (table 1).

Essential roles of CENPJ in centrosomal integrity, centrioles duplication and elongation, mitotic spindle assembly/disassembly, and in mitosis are well established.13–16 It localises to the centrosome where it docks itself on the centrioles through PCNT to facilitate mitotic spindle nucleation.17 18 Depletion of CENPJ resulted in arrest of cells in mitosis.13 Thus, there is a strong body of data to support the essential role of CENPJ in the regulation of cell cycle through its action on the centrosome. Additionally, CENPJ also works as a transcriptional cofactor to STAT5 which plays an important role in regulating cell growth, differentiation, and survival.19 Taken together, the above data make it possible to speculate on the mechanism of PD phenotype we observe in this family with CENPJ mutation.

Before this study, three mutations were reported in CENPJ and all result in primary microcephaly rather than PD (table 1).20 21 The reason why our mutation appears to behave differently is unclear but we propose two potential explanations. It is possible that the previously reported mutations only affected brain specific transcripts whereas our mutation perturbed, in addition, transcripts that promote cellular proliferation elsewhere in the body. The second possibility is that the CENPJ mutation is insufficient to cause PD and that one or several modifiers permitted CENPJ related PD to manifest. The fairly consistent phenotype in five different cousins makes it, statistically at least, unlikely that the same modifiers have segregated independently with the CENPJ mutation in each of the affected patients. However, while we were unable to identify any obvious candidate, the linkage interval may harbour such modifier(s) resulting in a ‘digenic’ inheritance.

In summary, this is the first report of Seckel syndrome caused by CENPJ mutation. We believe that the relationship between primary microcephaly and PD should be revisited in view of the recent revelation of overlapping molecular mechanisms between the two disorders. Importantly, the contribution of other microcephaly genes to the causation of Seckel syndrome should be actively investigated, particularly in those with no identifiable PCNT mutations.

References

View Abstract

Footnotes

  • MSA-D and RS contributed equally to this work.

  • Funding KFSHRC.

  • Competing interests None.

  • Patient consent Obtained.

  • Ethics approval This study was conducted with the approval of the KFSHRC IRB #208006.

  • Provenance and peer review Not commissioned; externally peer reviewed.

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.