Article Text

Download PDFPDF

Multiexon deletions account for 15% of congenital myasthenic syndromes with RAPSN mutations after negative DNA sequencing
  1. Karen Gaudon1,
  2. Isabelle Pénisson-Besnier2,
  3. Brigitte Chabrol3,
  4. Françoise Bouhour4,
  5. Laurence Demay1,
  6. Asma Ben Ammar5,6,
  7. Stéphanie Bauché5,7,
  8. Christophe Vial4,
  9. Guillaume Nicolas2,
  10. Bruno Eymard5,7,8,
  11. Daniel Hantaï5,7,8,
  12. Pascale Richard1,9
  1. 1AP-HP, UF Cardiogénétique et Myogénétique, Service de Biochimie Métabolique, GH Pitié Salpêtrière, Paris, France
  2. 2Centre de référence Maladies Neuromusculaires Nantes-Angers, Département de Neurologie, CHU Angers, France
  3. 3AP-HM, Service de Neuropédiatrie, Hôpital La Timone-Enfants, Marseille, France
  4. 4Service d‘Electroneuromyographie et Pathologies Neuromusculaires, Hôpital Neurologique, GH Lyon Est, Bron, France
  5. 5Inserm, U975, CRICM, GH Pitié Salpêtrière, Paris, France
  6. 6INN, La Rabta, Université Tunis El Manar, Tunis, Tunisia
  7. 7UPMC, Université Pierre et Marie Curie, Paris, France
  8. 8AP-HP, Centre de Référence en Pathologie Neuromusculaire Paris-Est, GH Pitié Salpêtrière, Paris, France
  9. 9Inserm, U956, UPMC, Université Pierre et Marie Curie, Paris, France
  1. Correspondence to Dr Daniel Hantaï, INSERM U.975 - Institut de Myologie, Hôpital de la Salpêtrière, 47, Boulevard de l'Hôpital, Paris 75013, France; daniel.hantai{at}upmc.fr

Abstract

Congenital myasthenic syndromes (CMS) are a heterogeneous group of genetic disorders that give rise to a defect in neuromuscular transmission. We described here three patients with a characteristic phenotype of recessive CMS and presenting mutation in the gene encoding rapsyn (RAPSN). Familial analysis showed that one allelic mutation failed to be detected by direct sequencing. An allelic quantification on patient's DNA identified three novel multi-exon deletions of RAPSN. These three genomic rearrangements in RAPSN represent 15% of our CMS patients with RAPSN mutations and we emphasize that single-nucleotide polymorphism markers and a gene dosage method should be performed in addition to DNA direct sequencing analysis particularly when there is a genetic counselling issue.

  • Congenital myasthenic syndrome
  • rapsyn
  • chromosomic microdeletion
  • loss of heterozygosity
  • allele copy number
  • molecular genetics
  • neurology
  • neuromuscular disease
  • neurosciences
View Full Text

Statistics from Altmetric.com

Post-synaptic congenital myasthenic syndromes (CMSs) (OMIM 608931) comprise a group of genetic disorders affecting neuromuscular transmission which, in 80% of cases, is due to acetylcholine receptor (AChR) deficiency.1 These autosomal recessive CMSs may be caused by mutations in genes encoding the AChR or one of the AChR clustering or anchoring proteins, rapsyn, Dok-7 or MuSK.1–4 Spectra of rapsyn mutations show allelic heterogeneity and suggest that the common substitution p.Asn88Lys (N88K) (variant_021217 in Q13702) results in less stable AChR clusters.5 Until recently, all patients harbouring mutations in RAPSN are either homozygous for the p.Asn88Lys substitution or heteroallelic for p.Asn88Lys and a mutation which is in most of cases an amino acid substitution but can be also a null allele.6 Analysis of disease severity in patients suggested that the second mutant allele may largely determine severity of the phenotype.7 Recently, a patient with two non-p.Asn88Lys in RAPSN has been described and the first chromosomal deletion event was described by Müller and colleagues.8 9

When analysing 20 patients presenting recessive CMS for RAPSN mutations, three of them were found to be carriers of different large (multi-exonic) but partial deletions of RAPSN that could not be identified by gene sequencing.

Patient 1 is a 22-year-old woman who presented with a severe generalised hypotonia at birth with arthrogryposis, retrognathism and amimic face with no sucking reflex. There was no respiratory problem or dysphagia. She achieved independent walking on tiptoes at 16 months and presented several episodes during which she was unable to walk. At age 17, she showed a mild proximal muscle weakness in all four limbs and in neck flexors, a reduced mouth opening, and a slight limitation in left eye abduction. Electromyography (EMG) demonstrated a clear decrement on 3 Hz repetitive stimulation in trapezius and quadriceps muscles.

Patient 2 is a 27-year-old woman who presented with a severe generalised hypotonia at birth with arthrogryposis of the ankles, knees, elbows, and fingers. She had facial diplegia, respiratory failure with weak cries, no suction, no swallowing, and a permanent defect of orbicular muscles of lips and eyes. The diagnosis of CMS was confirmed after a negative test for AChR antibodies, a 15% decrement, and a positive prostigmine test.

Patient 3 is a 7-year-old girl with no family history. At birth, a major hypotonia and arthrogryposis of the hands and feet were noted. She was not able to swallow and had frequent episodes of respiratory failure leading to requirement for mechanical ventilation. The prostigmine test was positive and the EMG showed a decrement confirming the diagnosis of CMS.

Molecular analyses in patient 1 revealed an ‘apparently’ homozygous RAPSN substitution (c.264c>a), p.Asn88Lys transmitted by the unaffected mother but not carried by the father, suggesting a ‘missed’ variant not detected by the usual sequencing approach.

In both patients 2 and 3, the missense p.Asn88Lys substitution was identified on a single allele with no identification of the second allelic mutation. In both families, the heterozygous parent for p.Asn88Lys was the mother. We determined the RAPSN copy number in each patient, using three single nucleotide polymorphisms (SNPs) known to cosegregate (rs7111873, rs34729771 and rs7126210; figure 1). In these three patients, the SNPs do not cosegregate correctly. In patient 1, rs34729771 and rs7126210 SNPs were heterozygous while rs7111873 was homozygous. In patient 2, only the SNP rs7111873 was heterozygous. In patient 3, only rs7111873 and rs34729771 were heterozygous. A relative quantification for each exon of RAPSN was performed by a quantitative PCR (qPCR) approach. In patient 1, a deletion involving 5′UTR, promoter, exon 1 and exon 2 was detected (figure 2). Partial delimitation of breakpoints showed that the deletion corresponding to a ∼30 kb occurred between rs2242081 and intron 2. In patient 2, allelic quantification confirmed the loss of exon 3–7 on one allele, and the long range PCR/sequencing showed that the recombination occurred between a short sequence of seven nucleotides (CCTGCAG) in intron 2 at the junction with exon 3 (c.532–7; c.532–1) and the same sequence at the 5′ end of exon 8 (c.1170_1176), resulting in a deletion spanning 4.785 kb (g.47 416 165_47 420 949del). In patient 3, the deletion involves exon 7 to 8 and part of 3′UTR and the recombination occurred between two sequences of 25 nucleotides (GCTAATTTTTGTATTTTTAGTAGAG), the first located in intron 6 (c.967-398_967–374) and the other one located in 3′UTR region, resulting in a deletion of 10.334 kb (g. 47 417 456_47 407 123del). The allele quantification was performed in the parents and showed that in the three families, the chromosomal microdeletion was transmitted by the father (for experimental details see supplementary data files 1 and 2).

Figure 1

Schematic representation of RAPSN. Exons are numbered from 1 to 8. The common p.Asn88Lys substitution and the three known allelic single nucleotide polymorphisms (SNPs) are indicated by arrows. Presence or absence of these polymorphisms for the three patients is indicated: presence of the SNP heterozygous (+); absence of the SNP (−).

Figure 2

Graphic representation of the relative quantification of RAPSN exons. Results were expressed in N-fold changes in RAPSN exon copies, normalised to β-globin relative to the copy number of the target gene. When 0.8<N-fold<1.7, the DNA sample harboured two copies of the RAPSN exon. If N-fold was <0.7, the sample harboured only one copy of the exon. Quantitative PCR in patients revealed a clear reduction to about 50% for the deleted exons, exon 1 and 2 in patient 1, exons 3 to 7 in patient 2, and exons 7 and 8 in patient 3.

In our series of CMS patients recruited via the French CMS National Network, 20 patients were found with disease-causing mutations in RAPSN. Among these patients, three (15%) had the recurrent p.Asn88Lys substitution, but the sequencing approach failed to identify the second allelic mutation. We hypothesised that genomic deletions may account for this second mutation in these patients and developed a simple molecular assay based on qPCR analysis. This led us to identify three different chromosomal microdeletions due to recombinations. All these multi-exon deletions corresponded to the missing disease-causing allelic mutation in patients.

The description of Müller and colleagues9 and ours demonstrates that RAPSN, containing numerous repeated sequences, is particularly subject to multiple genomic recombinations. Determination of the precise deletion breakpoints showed that the recombination involves multiple and different sequences in the three patients.

Altogether these findings lead to the following comments: (1) a negative result obtained by direct sequencing of genomic DNA raises the question of an incomplete detection of some mutations; (2) in recessive transmissions, analysis of the patient's parents is crucial to confirm the inheritance; (3) phenotype–genotype correlations should also be considered: while patient 1 did not exhibit a very severe phenotype during childhood, patients 2 and 3 presented with a CMS with all the criteria of severity corresponding to the phenotype most often observed in patients carrying the p.Asn88Lys substitution associated with another allelic mutation.10

In conclusion, this mutational mechanism represents 15% of patients with RAPSN mutations referred to our laboratory. For diagnostic purposes, carrier detection, genetic counselling, and prenatal diagnosis, it is critical to know the exact functional gene copy number that an individual carries.

Acknowledgments

The authors would like to thank the patients and their families for their helpful collaboration. This work was supported by Assistance Publique-Hôpitaux de Paris (PHRC AOM 1036), Réseaux Inserm, ANR-Maladies Rares (ANR-07-MRAR-001), Association Française contre les Myopathies and a Contrat d'Interface AP-HP Inserm (to DH).

References

View Abstract

Footnotes

  • DH and PR are co-last authors.

  • Funding ANR, AFM, Inserm, APHP.

  • Competing interests None.

  • Patient consent Obtained.

  • Ethics approval This study was conducted with the approval of the GH Pitié-Salpêtrière, Paris, France.

  • Provenance and peer review Not commissioned; externally peer reviewed.

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.