Naevoid basal cell carcinoma syndrome (NBCCS; OMIM 109400), also known as Gorlin’s syndrome, is an autosomal dominant disorder characterised by multiple basal cell carcinomas (BCCs), recurrent odontogenic keratocysts, skeletal anomalies, intracranial calcification and developmental malformations.1 2 The estimated prevalence of NBCCS is 1 in 57 000 to 1 in 164 000 of the general population.3^–6

In mammals, the hh family has three different types of HH proteins, SHH, Indian HH and Desert HH (DHH ), two patched receptors, PTCH1 and PTCH2, and three ci-like proteins, GLI1, GLI2 and GLI3.7 In addition, mammals have a HH-interacting protein, not found in Drosophila, which appears to function as a regulator of ligand availability.8 Of all the HH proteins, SHH is the best-characterised homologue. The receptor for SHH is the product of the tumour-suppressor gene, PTCH. In addition, the PTCH protein acts as a negative regulator of SHH and, in the absence of SHH, PTCH represses the activation of SMO, thereby blocking the expression of the downstream target genes, such as GLI.9

Growing evidence indicates that the pathogenic mechanism of NBCCS is related to the Shh signalling pathway ,and involves a number of genes, including SHH, PTCH, PTCH2, SMO, HIP and the Ci/GLI family.10^–14 Mutations in PTCH have been found in some patients with familial and sporadic NBCCS.15^–18 Somatic mutations in PTCH2, a homologue of PTCH, have been identified in BCC and in medulloblastoma.19 In addition, mutations in SMO and SHH have been found in sporadic BCC. Notably, both medulloblastoma and sporadic BCC are features of NBCCS.20 21 Therefore, the pathogenicity of NBCCS might also involve other genes of the Shh signalling pathway, in particular SHH, PTCH2 and SMO.

In this present study, clinical examinations of 25 members of a Chinese Han family with NBCCS were conducted. PTCH, SHH, PTCH2 and SMO were chosen as candidate pathogenic genes of NBCCS for mapping and mutation screening. We found one novel mutation, a G→A transition (2157G→A) in exon 15 of the PTCH2 gene in this family with NBCCS, and this mutation caused inactivation of the PTCH2 inhibitory activities.

METHODS

Subjects

The study was conducted with the consent of all family members and was approved by the ethics committee of the Chinese National Human Genome Centre, Beijing. In total, 6 patients with NBCCS and 19 normal members of one Chinese Han family were included in the study (fig 1). All the family members were examined by two experienced oral and maxillofacial surgeons and examined radiographically for features such as intracerebral calcifications, bifid ribs and odontogenic keratocysts. The control group comprised 520 unrelated people without any hereditary disorders. Samples of peripheral blood were taken from all members, into tubes with EDTA as anti-coagulant.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1 Pedigree diagram of a Chinese Han family with NBCCS. There were 39 members among four generations in this family with NBCCS, including nine patients with NBCCS (six are alive). Arrowhead, proband; filled symbols, patients with NBCCS; open symbols, normal family members. According to genetic analysis, NBCCS is an autosomal dominant disease. The D1S193-D1S2724 haplotype in III:11 to III18 and IV:10 to IV:13 were checked after linkage analysis. All patients with NBCCS had the same haplotype of genetic markers from D1S2802 to D1S2797 (black frame). There was no recombination in this chromosomal region.

Sequencing

Genomic DNA was extracted from peripheral blood leukocytes using the method recommended by Miller.22 Intronic primers of PTCH2 (supplementary table 1) for PCR amplification of the exons were also used for sequencing the PCR products. Primers were designed using Primer 3 software (Whitehead Institute, Cambridge, Massachusetts, USA). PCR amplification was performed for 15 min at 95°C, followed by a touchdown program of denaturation for 30 s at 94°C, annealing for 1 min at 63°C with the annealing temperature decreased by 0.5°C for each of the initial 15 cycles, and extension for 1.5 min at 72°C. The annealing conditions then remained at 58°C for 40 s for the subsequent 25 cycles and the extension was reduced to 60 s at 72°C. A final extension was performed for 10 min at 72°C. The amplification products were purified using a MultiScreen-PCR plate (Millipore, Billerica, Massachusetts, USA). Cycle sequencing was performed using a commercial kit (Big Dye Deoxy Terminator Cycle Sequencing kit; Perkin-Elmer Comp., Waltham, Massachusetts, USA) according to the manufacturer’s instructions. All sequencing was performed on an automated analyser (ABI Prism 3700 DNA Analyzer; ABI Inc). Results were analysed using BioEdit software and the Blast program on the National Center for Biotechnology Information (NCBI) website.

GeneScan and linkage analysis

Five microsatellite markers covering the gene locus for SHH (D7S2465, D7S2546, D7S1823, D7S550 and D7S559), SMO (D7S504, D7S1875, D7S530, D7S2544 and D7S2519) and PTCH (D9S1689, D9S1809, D9S1786, D9S1851 and D9S280), and eight microsatellite markers covering the PTCH2 locus (D1S193, D1S211, D1S2733, D1S2802, D1S2797, D1S2874, D1S2824 and D1S2724), were chosen for the GeneScan analysis. Marker primers were obtained from the NCBI website and labelled with FAM or HEX. After PCR, the GeneScan analysis was carried out on an automated analyser as before. The results were analysed using GeneMapper V.3.1 and Linkage V.5.1 software.

Restriction enzyme identification

The PCR product was designed to have only one AvaI restriction enzyme site (forward primer: ctgtccctctccctcttctc, reverse primer: ggtgtctctgtccccactc). An analytical restriction enzyme digestion was performed at 37°C for 4 h in a 20-μl reaction volume containing 1 μg PCR product, 2 μg acetylated bovine servum albumin and 5 U AvaI (Promega Inc, Madison, Wisconsin, USA). After the digestion, 4 μl loading buffer was added and restriction fragments were analysed on a 1% agarose gel.

Expression constructs

Human full-length PTCH2 cDNA in the His-pCDNA3.1 plasmid (gift from Professor Å Bergström) and the 8XGLI1 luciferase reporter construct and wild-type SMO-pCDNA3.1 construct (American Type Culture Collection, Manassas, Virginia, USA) were used. The PTCH2 (2157G→A) mutation was generated using the a commercial kit (QuikChange Site-Directed Mutagenesis Kit; Stratagene, Inc., La Jolla, California, USA). His-tagged PTCH2 and His-tagged PTCH2 (2157G→A) were subcloned into the pQCXIP retroviral vector using AgeI and MfeI restriction sites.

Gli1-luciferase reporter assays

C3H10T1/2 cells were plated at 2.0×104 cells/well (24-well plate) 24 h before transfection. Cells were cotransfected with 5 ng Renilla reniformis, 0.1 μg 8XGLI1 luciferase reporter construct, 0.15 μg wild-type SMO construct and 0.15 μg of the appropriate PTCH2 construct (wild-type PTCH2 or PTCH2 (2157G→A)) or control vector (His-pCDNA3.1) using a transfection reagent (FuGENE 6; Roche, Inc., Basel, Switzerland, with a 3:1 ratio (v/w) of reagent to DNA. Luciferase assays were performed using a dual-luciferase reporter assay system (Promega), 48 hours after transfection. All reporter assays were normalised with Renilla.

Cell culture and retroviral infection

NIH3T3 and C3H10T1/2 cell lines were maintained in Dulbecco’s modified Eagle’s medium with 10% fetal calf serum. Retroviruses were generated by transfecting the retroviral construct into 293T cells, and retrovirus-containing supernatant was collected and stored at −70°C. Cells were infected with retroviruses in the presence of 4 μg/ml polybrene, and 48 hours after infection, cells were selected with puromycin (2 μg/ml) for 1 week. The resistant clones were pooled and confirmed by Western blotting.

Cell fractionation and Western blot analysis

The cell fractionations were performed as described previously.23 Proteins were separated by 10% sodium dodecyl sulphate–polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane using a semidry transfer apparatus (Bio-Rad Laboratories, Hercules, California). The membranes were probed with monoclonal antibodies against His (1:1000; BD Biosciences Clontech, Mountain View, California, USA) and cyclin D1 (1:500; A-12, Santa Cruz Inc., Santa Cruz, California, USA). The blots were stripped and reprobed with monoclonal antibodies against α-tubulin (1:100 000; Sigma-Aldrich, St Louis, Missouri, USA) as an internal control. All Western blots were probed with the appropriate horseradish peroxidase-conjugated secondary mouse antisera (Amersham Pharmacia Biotech, Amersham, Buckinghamshire, UK) at a dilution of 1:3000, and proteins were detected by enhanced chemiluminescence (Amersham).

Cell proliferation assays

NIH3T3 stable cell lines (pQCXIP, His-tagged PTCH2-pQCXIP and His-tagged PTCH2 (2157G→A)-pQCXIP) were seeded at a density of 1.0×104 cells/plate (60-mm plates). Cells were counted 3, 5 and 7 days after seeding. The results shown represent the mean values (SEM) of three separate experiments.

Statistics

All statistical calculations were performed using SPSS V.10 statistical software (SPSS Inc, Chicago, Illinois, USA). Student t-test was used to determine the significance of luciferase reporter assays and cell proliferation assays, and p<0.05 was considered significant.

RESULTS

After comprehensive clinical examination, six members of this family had some NBCCS phenotypes. All affected members had palmar pits, one 17-year-old boy had bifid rib, one 25-year-old woman had odontogenic keratocysts of the jaw, and one 57-year-old woman patient had multiple BCCs and mild hypertelorism (table 1, fig 2).

• Download figure
• Open in new tab
• Download powerpoint

Figure 2 Clinical features of the Chinese Han family with NBCCS. Radiographic film showing (A) multiple odontogenic keratocysts of the jaw (arrows) in patient IV:11 and (B) bifid rib (arrows) in patient IV:10. (C) Photograph of palmar pits in patient III:14. (D) Basal cell carcinoma from patient III:14 showing many mitoses in cancer nests (bar: 200 um).

Linkage and haplotype analysis identified the location of the NBCCS-associated locus to between markers D1S2733 and D1S2874 in chromosome 1. The maximum LOD score showed that two microsatellite markers near PTCH2 supported a linkage with NBCCS: D1S2797 (maximum LOD score 1.31, θ = 0.00) and D1S280 (maximum LOD score 1.26, θ = 0.00) (fig 1). However, microsatellite markers located near each of the genes SHH, PTCH and SMO were negative for linkage analysis (supplementary tables 2–5), thus did not indicate that these gene loci have linkage with NBCCS.

Direct sequencing and AvaI digestion identified a G→A transition (2157G→A) (GI: 22538485, NM_003738) in exon 15 of PTCH2 in all six patients with NBCCS (fig 3A,B). However, the 2157G→A mutation was not found in any of the 19 normal family members nor in the 520 normal, unrelated controls (1040 chromosomes). The mutation resulted in codon CAG (R) changing to CGG (Q), resulting in a change of arginine at position 719 to glutamine (R719Q) (GI: 22538486, NP_003729; NCBI Blast program) in an extracellular loop of the PTCH2 protein. The PTCH2 protein is evolutionarily conserved in Ptch2 orthologues of human, mouse and Xenopus laevis and in Ptch orthologues of human, mouse, rat, Xenopus laevis and zebrafish (fig 3C). No mutation was found in other exons of PTCH2 nor in any exons of SHH, SMO, or PTCH (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

Figure 3 Identification of PTCH2 mutation. (A) The 2157G→A mutation in exon 15 of the PTCH2 gene, showing G→A transition mutation (arrow) in (top) normal control and (bottom) patient.(B) PCR products after AvaI restriction digest. Lanes 1 and 10, molecular markers; lanes 2–7, patient samples showing three products (128, 280 and 408 bp); lanes 8 and 9, normal samples showing two products (128 and 280 bp). Undigested PCR product (not shown) is 408 bp. (C) Sequence alignment of the PTCH2 mutation and an additional 59 amino acids in the Ptch2 protein from various Ptch families and species. Blue, conserved amino acid residues; bold red, mutated amino acid R719Q (arrowed).

To examine whether the R719Q mutation affects PTCH2 function, the GLI1-luciferase reporter construct containing eight copies of a GLI1 binding site was used to monitor GLI activation. C3H10T1/2 cells were transiently transfected with the reporter plasmid and with expression constructs for wild-type SMO, wild-type PTCH2 and the PTCH2-R719Q mutant and the luciferase activity in the cell lysates measured 48 h after transfection. Transfection of human wild-type SMO induced GLI-dependent transcription. Whereas cotransfection of human wild-type PTCH2 suppressed SMO-induced GLI reporter activity, PTCH2-R719Q failed to suppress GLI reporter activity (fig 4A, p<0.05).

• Download figure
• Open in new tab
• Download powerpoint

Figure 4 PTCH2-R719Q lacks inhibitory activity. (A) Luciferase activity in SMO+PTCH2-R719Q cells was significantly higher than that in SMO+PTCH2 cells (p<0.05) Results are mean (SD) fold induction of duplicates from three separate experiments. (B) Growth curves of NIH3T3 cells stably expressing empty vector, PTCH2 or PTCH2-R719Q. Results are mean (SD) from three separate experiments. There were significantly higher numbers of cells expressing PTCH2-R719Q than those expressing PTCH2 (p<0.05). (C) (Left) Expression of His-tagged PTCH2 protein in cell lysates from NIH3T3 cells infected with retroviral vectors: lane 1, pQCXIP; lane 2, PTCH2-R719Q-pQCXIP; lane 3, wild-type PTCH2-pQCXIP. (Right) Cyclin D1 expression in equal protein loading of (top) cell lysates; (bottom) α-tubulin antisera.

The effect of the PTCH2 mutation on cell proliferation was also examined. NIH3T3 cells stably expressing wild-type PTCH2, PTCH2-R719Q or control vector were generated. Cell proliferation was monitored for 7 days after seeding, with cells counted every 2 days (fig 4B). Overexpression of wild-type PTCH2 significantly inhibited cell growth compared with the control vector (p<0.05). In contrast, PTCH2-R719Q-expressing cells grew at a similar rate to the control cells. Cyclin D1 is an Shh signalling pathway target gene and plays a central role in cell proliferation.24 25 Western blot analysis revealed that the expression of cyclin D1 was significantly reduced in wild-type PTCH2-expressing cells compared with control cells, whereas there was no difference between PTCH2-R719Q-expressing cells and control cells (fig 4C). From these data, we conclude that downregulation of cyclin D1 occurred because wild-type PTCH2 inhibited the Shh signalling pathway whereas PTCH2-R719Q lost its inhibiting function in the Shh signalling pathway, allowing expression of cyclin D1 to return to the normal level.

DISCUSSION

NBCCS is an autosomal dominant disorder. Its pathogenic mechanism involves genes of the Shh signalling pathway, and PTCH mutations have been found in familial and sporadic NBCCS and related tumours.12^–15 Somatic mutations in the PTCH2, SMO and SHH genes have been identified in sporadic BCC and medulloblastoma, both of which are features of NBCCS.18^–21 In the present study, one Chinese Han Family with NBCCS was investigated. Linkage analysis revealed that the NBCCS-associated locus was located between markers D1S2733 and D1S2874 in chromosome 1, with the maximum LOD being 1.31 for D1S2797 and 1.26 for D1S2802. PTCH2 was located in that NBCCS-associated locus, suggesting that PTCH2 is linked with NBCCS in this family.

PTCH2 was identified as the aetiological gene in this family based on the positional results. After screening all exons of PTCH2, a G→A transition (2157G→A) in exon 15 of the PTCH2 gene was identified in all patients with NBCCS of this family but not in normal family members or in 520 normal controls. The mutation led to an arginine→glutamine amino acid substitution at position 719, in an extracellular loop of the PTCH2. PTCH2, a homologue of PTCH, is composed of 22 coding exons spanning ∼15 kb of genomic DNA. The PTCH2 gene encodes a putative transmembrane protein of 1203 amino acids, which has high homology to the PTCH product.18 The PTCH2 protein is the receptor for SHH, a secreted molecule implicated in the formation of embryonic structures and as a tumour-suppressor gene. However, to date, the biological function of PTCH2 has not been fully understood. Tissue distribution analysis indicates that PTCH2 is preferentially expressed in skin and testis. Binding analysis shows that both PTCH1 and PTCH2 can interact with all HH family members with similar affinity, and form a complex with SMO.26 Suppression of hair-follicle development inhibits induction of Shh, Ptch1 and Ptch2 in hair germs in mice.27 Thus PTCH2 appears to be involved in SHH/PTCH cell signalling. Mutations in this gene have been found in sporadic medulloblastoma and BCC, suggesting that it has a tumour-suppressor function.18 As a homologue of PTCH, the role of PTCH2 may be similar to that of PTCH in patients with NBCCS. However, in developing epidermal structures, PTCH2 is coexpressed with SHH, suggesting that PTCH2 may play a different role from PTCH in epidermal development.14 Previously, it was reported that medulloblastoma arising from perturbations of PTCH function leads to a concomitant upregulation of PTCH2. Using knockout mice, Nieuwenhuis et al found that Ptch2^−/− mice are viable. Interestingly, adult Ptch2^−/− male animals develop skin lesions consisting of alopecia, ulceration and epidermal hyperplasia, suggesting that normal Ptch2 function is required for adult skin homeostasis.28 This Ptch^−/− mice phenotype is similar to, but somewhat milder than the phenotype in this family with NBCCS. All patients had epithelial tissue lesions (especially in the epidermal layer) and palmar pits, but bifid rib and mild hypertelorism were found in only one patient. These findings indicate that the genotype was closely connected with its clinical phenotype, and that loss of function of this PTCH2 mutation had some effects on development, but this effect is probably not very marked. Generally, for a tumour-suppressor gene to be inactivated, two hits are required. The first hit involves a mutation in one allele, which can be dominantly inherited if present in a germ line, but which is classically considered to have no phenotypic effect. The second hit involves loss of the other allele, known as loss of heterozygosity (LOH). When both alleles are inactivated, tumour growth occurs. LOH of PTCH or the activated mutant of SHH or SMO have been demonstrated in some tumours such as BCC, odontogenic keratocyst and medulloblastoma, which are three features of NBCCS.18 19 29 PTCH and PTCH2 are probably not classic tumour suppressor genes because the first (germ cell) hit alone may account for the malformations and their variability in patients with NBCCS, but for tumours such as BCC and medulloblastoma and for keratocysts, two hits are required. In this family with NBCCS, two affected members have multiple BCCs or multiple odontogenic keratocysts of the jaw. In addition to the PTCH2 mutation, it is possible that mutations resulting in PTCH allele loss or affecting SHH or SMO activation might have occurred in somatic cells, which caused the multiple BCCs or multiple odontogenic keratocysts of the jaw. Functional studies showed that the R719Q mutation impairs PTCH2 inhibitory function in the Shh signalling pathway. Furthermore, PTCH2-R719Q could not suppress cell proliferation and the expression of cyclin D1 compared with wild-type PTCH. Lee et a showed that loss of Ptch2 markedly promotes tumour formation in combination with Ptch1 haploinsufficiency.30 Taken together, these findings suggest that Ptch2 has a tumour-suppressor function.

In summary, this study identifies a novel mutation of PTCH2 in patients with NBCCS, which results in loss of PTCH2 inhibitory function. This mutated PTCH2 underlies NBCCS in a Chinese Han family.