Article Text

Download PDFPDF

Interleukin 12 gene polymorphisms enhance gastric cancer risk in H pylori infected individuals
  1. F Navaglia1,
  2. D Basso1,
  3. C-F Zambon2,
  4. E Ponzano3,
  5. L Caenazzo3,
  6. N Gallo1,
  7. A Falda1,
  8. C Belluco4,
  9. P Fogar2,
  10. E Greco1,
  11. F Di Mario5,
  12. M Rugge6,
  13. M Plebani1
  1. 1Department of Laboratory Medicine, University Hospital of Padua, Padua, Italy
  2. 2Department of Medical and Surgical Sciences, University of Padua
  3. 3Department of Environmental Medicine and Public Health, Section of Legal Medicine, University of Padua
  4. 4Department of Oncological and Surgical Sciences, University of Padua
  5. 5Department of Gastroenterology, University of Parma, Parma, Italy
  6. 6Department of Pathology, University of Padua
  1. Correspondence to:
 Professor Mario Plebani
 Department of Laboratory Medicine, University Hospital of Padova, Via Giustiniani 2, 35128 Padova, Italy;

Statistics from

Bacterial, environmental, population related, and individual host factors are major determinants of the outcome of Hpylori infection.1,2 Many bacterial virulence genes—including the pathogenicity island cagA, the s1m1 vacA alleles, babA2, sabA, and oipA—have been associated with a higher degree of gastric mucosal inflammation, intestinal metaplasia, gastric or duodenal ulcer, gastric adenocarcinoma, and MALToma.1,3–7Hpylori triggers and maintains gastric mucosal inflammation by different mechanisms, which are partly strain dependent and partly strain independent.1 T and B lymphocyte activation and infiltration of the gastric mucosa depend on Hpylori antigen processing. The number of infiltrating polymorphonuclear cells varies depending on the virulence of the infecting strain, being much greater when infections are caused by cagA positive strains.3,5,7–9

The inflammatory cells infiltrating Hpylori infected gastric mucosa produce a pattern of proinflammatory cytokines.10,11 High mucosal levels of mononuclear cytokines (IL8, IL6, IL1β, tumour necrosis factor α (TNFα), and interferon γ (IFNγ)) and lymphocytic derived cytokines (IL2, IL2R) have been described in Hpylori infected patients.10–13Hpylori infection also induces the production of IL12,14–16 a heterodimeric proinflammatory protein that triggers the production of IFNγ and favours the differentiation of T helper 1 (Th1) cells,17,18 which, in Hpylori infected mucosa, prevail over Th2 cells.15,16,19 The ability of IL12 to induce Th1 is one of the biological bases of the importance of this cytokine in resisting most bacteria, including Hpylori, and also intracellular protozoa and fungal pathogens.18,20,21 Cellular sources of IL12 in response to infections are mainly dendritic cells and phagocytes.16–21 The two subunits of IL12—p35 and p40—are encoded by different genes, named IL12A and IL12B respectively, which are unrelated and are located on separate chromosomes (3p12–q13.2 and 5q31–33).18

Host cytokine gene polymorphisms may be as important as exogenous stimuli in influencing the amount of cytokines produced and consequently the pattern and severity of inflammation.10,22–26 IL12 gene polymorphisms in particular have been observed to affect autoimmune diabetes27 and atopic and non-atopic asthma.28 Both IL12A and IL12B have a polymorphic dinucleotide repeat region (CT for IL12A and TG-TA for IL12B) in introns 6 and 4, respectively (Gene bank accession numbers: AF404773 for IL12A and AY008847 for IL12B), which might affect the amount of the synthesised cytokine. No data have been reported on the possible influence of IL12A and IL12B polymorphisms on Hpylori infection and its outcome.

Our aims in the present study were, first, to use denaturating high performance liquid chromatography (DHPLC) to screen the promoters and the coding sequences of IL12A and IL12B in order to identify any single nucleotide polymorphisms (SNPs); second, to analyse the SNPs identified, together with the number of CT and TG-TA dinucleotide repeats (variable number tandem repeats (VNTR)) of IL12A intron 6 and IL12B intron 4 in patients with or without Hpylori infection; and third, to verify the association, if any, between the IL12 gene polymorphisms studied and the outcome of Hpylori infection (gastric adenocarcinoma in particular).

Key points

  • IL12, formed from p35 and p40 subunits encoded by IL12A and IL12B genes, favours T helper 1 (Th1) differentiation. Th1 lymphocytes prevail over Th2 in Hpylori associated chronic gastritis, the first step in Hpylori associated gastric carcinogenesis. In this study, 110 patients with non-cardia gastric cancer were compared with 251 patients with benign gastroduodenal diseases to see whether there was any correlation between IL12 gene polymorphisms and Hpylori associated gastric adenocarcinoma.

  • Two single nucleotide polymorphisms were identified on IL12A (−504 T/G and +6686 A/G) and one on IL12B (+15485 A/G). Eleven and six alleles were found for CT and TG-TA dinucleotide repeats (VNTR) of IL12A intron 6 and IL12B intron 4, respectively.

  • The frequency of non-cardia gastric cancer was higher in patients with the IL12A −504 T/T (odds ratio (OR) = 2.38) or with the IL12B VNTR (TG-TA)9/(TG-TA)11 genotype (OR = 1.36).

  • No IL12 gene polymorphisms were correlated with intestinal metaplasia.

  • These findings suggest that IL12A and IL12B gene polymorphisms may affect the final steps in gastric carcinogenesis in Hpylori infected subjects.


We studied 251 unrelated Italian patients (112 male, 139 female; age range 27 to 88 years) who consecutively underwent upper gastrointestinal endoscopy (EGDS, (o)esophagogastroduodenoscopy) for dyspeptic symptoms. Diagnoses made on the basis of endoscopic findings were: absence of evident endoscopic lesions (10); antral gastritis (94); diffuse gastritis (57); duodenal ulcer (30); gastric ulcer (10); duodenitis (22); reflux gastritis (16); oesophagitis (12).

Three antral and two body biopsies were obtained at endoscopy from each patient for histological evaluation. Two antral and one body biopsy were also obtained for Hpylori culture and genotyping. An EDTA-K3 treated blood sample was obtained from all patients for host genomic DNA isolation.

A second series of 110 unrelated Italian patients (66 male, 44 female; age range 34 to 90 years) who underwent surgery for non-cardia gastric cancer was also studied. TNM stages were: TNM IA (4); TNM IB (7); TNM II (30); TNM IIIA (18); TNM IIIB (10); and TNM IV (41). According to the Lauren description of gastric cancers, tumours were classified as “intestinal-type” in 82 patients and “diffuse” in 28. Two tissue samples for Hpylori genotyping and genomic DNA analysis were obtained from 50 non-cardia gastric cancer patients: one from the neoplastic area and another from the adjacent (but at least 3 cm distant) non-neoplastic mucosa. The tissue samples were stored at −80°C until DNA extraction was carried out. Whole blood from all patients with non-cardia gastric cancer was used to obtain genomic DNA. Sera were also obtained for measurement of anti-Hpylori antibodies.

Histological evaluation

In mucosal biopsies from patients who underwent EGDS, Hpylori colonisation density, chronic inflammation, polymorphonuclear cell infiltration (activity), and intestinal metaplasia were evaluated and graded according to the updated Sydney system.8 Non-cardia gastric cancer diagnosis was always confirmed histologically on samples taken intraoperatively.

H pylori culture and genotyping

In the series of 251 patients who underwent EGDS, Hpylori was cultured as described elsewhere.10 DNA extracted from positive colonies was used to amplify ureA, cagA, and vacA under conditions specified by us elsewhere.7 In the subgroup of 50 non-cardia gastric cancer patients for whom tissue samples were available, Hpylori infection and strain virulence gene characterisation were assessed in DNA extracted from tissue. UreA, cagA, and s1/s2 vacA were multiplex polymerase chain reaction (PCR) amplified in a 25 μl final reaction volume containing: 150 ng DNA, 1×PCR gold buffer (Applied Biosystems, Foster City, California, USA), 1.5 mM MgCl2, 200 μM each dNTPs, 500 nM primer URE-A F and URE-A R (5′gacatcactatcaacgaagg3′ and 5′tgaaaaccacgctctttag3′), 160 nM primer Cag-A F and Cag-A R (5′tcaaatacaccaacgcctcc3′ and 5′agcttcttgtggggacaatc3′), 600 nM primer S1/2-F and S1/2-R (5′atggaaatacaacaaacacac3′ and 5′ctgcttgaatgcgccaaac3′), and 2.5 U AmpliTaq gold (Applied Biosystems). The thermocycling conditions were: 95°C for six minutes, then 42 cycles at 94°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds, and finally 72°C for seven minutes. The fragments (323 base pairs (bp) for ureA, 194 bp for cagA, and 259 or 286 bp for s1 and s2 vacA, respectively) were separated by electrophoresis on 2% NuSieve 1% Seakem agarose gel (BMA, Rockland, Maine, USA) and stained with ethidium bromide. The PCR amplification conditions used for m1/m2 vacA are described by us elsewhere. 7 Past or actual Hpylori infection in the remaining 60 non-cardia gastric cancer patients was established on the basis of positive findings from serum anti-Hpylori antibodies (Inova Diagnostics, San Diego, California, USA).

Genomic DNA extraction and PCR amplification

Genomic DNA was extracted from 3 ml blood samples using the QIAamp DNA blood midi kit (Qiagen, Hilden, Germany). Promoters, coding sequences, splicing sites, and UTR regions of IL12A and IL12B were PCR amplified using the primers listed in table 1. Briefly, 100 ng of extracted DNA were amplified in a 50 μl final reaction volume under the following conditions: 1×DNA polymerase gold buffer (Applied Biosystems), 1.5 mM MgCl2, 200 μM each dNTPs, 500 nM each primer, and 2.5 U AmpliTaq gold (Applied Biosystems). PCR conditions were: 94°C for seven minutes, then 40 cycles at 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 60 seconds, and finally 72°C for 20 minutes.

Table 1

 Primer sequences, primer spanning regions, amplified regions, and temperatures of denaturating high performance liquid chromatography analysis

DHPLC analyses

PCR amplicons were analysed using a DHPLC screening strategy to detect any sequence polymorphisms (Transgenomic, Omaha, Nebraska, USA). This system uses the principles of reverse phase ion pair high performance liquid chromatography (RP-IP-HPLC) to carry out analytical separations of heteroduplexes. Table 1 reports temperatures for DHPLC analysis. The types of DNA polymorphism and their positions were defined by fluorescence dye terminator cycle sequencing on an ABI PRISM 310 genetic analyser (Applied Biosystems). Data were analysed with Sequencing Analysis 3.3 Software.

Capillary electrophoresis

IL12A intron 6 and IL12B intron 4 VNTRs polymorphisms were studied by capillary electrophoresis. Samples (100 ng) of genomic DNA were PCR amplified in a total reaction volume of 20 μl containing 1×PCR buffer with 1.5 mM MgCl2, 200 μM each dNTP, 1.25 U AmpliTaq DNA polymerase (Applied Biosystems), and 500 nM of the following dye labelled primer pairs: HEX-5′tgacgaggacatgggataaa3′ and 5′aagctcattgcctttcaaaca3′ for IL12A, and FAM-5′cagaggggaaaaggatggtt3′ and 5′cctggccagaactttttcaa3′ for IL12B. The temperature profile was: pre-PCR denaturation of seven minutes at 94°C; 30 seconds at 94°C; 30 seconds at 55°C; and one minute at 72°C for 30 cycles, and a final extension of 30 minutes at 72°C. Samples for capillary electrophoresis were prepared using 2 μl of amplified products, added to 20 μl deionised formamide and 0.5 μl GeneScan –500 ROX size standard (Applied Biosystems). The mixtures were heated at 95°C for three minutes and snap cooled at 4°C for three minutes. The samples were detected by using an ABI PRISM 310 genetic analyser with a 47 cm×50 μm capillary. Results were analysed using GeneScan Analysis software 3.7. The expected size ranges of the two polymorphisms were: IL12A VNTR (149–161 bp), IL12B VNTR (237–245 bp).

Allelic ladders for each VNTR were constructed by allele sequencing carried out on DNAs from homozygous samples.

Statistical analysis

Statistical analysis of data involved the χ2 test, logistic regression analysis, and the non-parametric Mann–Whitney U test.


Hpylori infection was diagnosed histologically in 36.4% of patients with no evident endoscopic lesions, 46.3% with antral gastritis, 43.6% with diffuse gastritis, 72.4% with duodenal ulcer, 77.8% with gastric ulcer, 36.4% with duodenitis, 60% with reflux gastritis, and 36.4% with oesophagitis. In patients with non-cardia gastric cancer, Hpylori infection was diagnosed on the basis of positive ureA findings in tissue samples in the subgroup of 50 non-cardia gastric cancer patients for whom tissue samples were available; in the remaining 60 non-cardia gastric cancer patients, Hpylori infection was established on the basis of positive findings from serum anti-Hpylori antibodies. Overall Hpylori infection was established in 69.4% of the non-cardia gastric cancer cases.

IL12A and IL12B gene polymorphisms

With DHPLC screening we identified three SNPs: two located in IL12A (−504 G/T and +6686 A/G) and one in IL12B (+15485 G/T) genes, respectively. The nucleotide substitutions were defined by sequencing. All SNPs were in Hardy Weinberg equilibrium (table 2). The IL12A −504 G/G genotype was extremely rare (1% of the cases) and for this reason the four patients with this genotype were excluded from some of the statistical analyses. A significant association was found between IL12A −504 and IL12A +6686 SNPs (χ2 = 16.52, p<0.01). In particular, the IL12A −504 T/G genotype was correlated with the IL12A +6686 G/G genotype, while the IL12A −504 T/T genotype was correlated with IL12A +6686 A/A or A/G genotypes; no association was found between IL12A −504 and IL12B +15485 (χ2 = 1.18, NS) or between IL12A +6686 and IL12B +15485 (χ2 = 4.05, NS).

Table 2

 Genotype frequencies and Hardy-Weinberg equilibrium analysis of the three single nucleotide polymorphisms studied

The number of GT repeats in intron 6 of IL12A (IL12A VNTR) and the number of TG-TA repeats in intron 4 of IL12B (IL12B VNTR) varied widely when patients were considered overall. Table 3 shows the VNTR allele frequencies of IL12A and IL12 B found in the present series. We genotyped IL12A and IL12B VNTRs by selecting the most common alleles ((GT)18, (GT)20, and (GT)21 for IL12A VNTR; (TG-TA)9 and (TG-TA)11 for IL12B VNTR) and combining them, as reported in table 4. The IL12A VNTR genotypes (GT)18/(GT)20, (GT)18/(GT)21, (GT)20/(GT)20, and (GT)20/(GT)21 were significantly correlated with IL12A −504 T/T, whereas (GT)18/(GT)others, (GT)20/(GT)others, and (GT)others/(GT)others were correlated with the IL12A −504 T/G genotype (χ2 = 68.59, p<0.001). The IL12A VNTR genotypes (GT)18/(GT)18, (GT)18/(GT)20, (GT)18/(GT)others, (GT)20/(GT)others, and (GT)others/(GT)others were correlated with the IL12A +6686 G/G genotype, whereas (GT)18/(GT)21, (GT)20/(GT)21, and (GT)21/(GT)others were correlated with the IL12A +6686 A/G genotype (χ2 = 244.51, p<0.001) (fig 1). The IL12B VNTR genotype was correlated with IL12B +15485 (χ2 = 24.04, p<0.01); in particular, the genotypes (TG-TA)9/(TG-TA)9, (TG-TA)9/(TG-TA)11, and (TG-TA)9/(TG-TA)others were correlated with IL12B +15485 A/A, whereas the (TG-TA)11/(TG-TA)11 genotype was correlated with IL12B +15485 A/G and G/G (χ2 = 24.04, p<0.01).

Table 3

 Variable number tandem repeat (VNTR) allele frequencies of IL12A intron 6 and of IL12 B intron 4 found in the present series

Table 4

 Variable number tandem repeat (VNTR) genotype frequencies of IL12A intron 6 and of IL12 B intron 4 found in the present series

Figure 1

 Association between IL12A variable number tandem repeats (VNTR) and IL12A +6686 genotypes. We genotyped IL12A VNTRs by considering separately the most common alleles ((GT)18, (GT)20, and (GT)21) and combining all the remaining alleles as “others” (OTH).

IL12A and IL12B polymorphisms and Hpylori infection

IL12A and IL12B SNPs or VNTRs were not correlated with Hpylori infection, cagA, s or m vacA, antral or body inflammation, and antral activity. Body activity was correlated with IL12B VNTR: mild to moderate body activity was more commonly recorded in patients with the (TG-TA)11/(TG-TA)11 genotype (χ2 = 47.75, p<0.001).

In relation to Hpylori positive patients, the only associations we found were those between IL12A −504 SNP and cagA (Fisher’s exact test, p<0.05; odds ratio = 2.34, 95% confidence interval (CI), 0.91 to 5.98) or IL12A −504 SNP and antral activity (χ2 = 8.83, p<0.05) (fig 2).

Figure 2

 Associations between IL12A −504 SNP and cagA or antral activity in Hpylori positive patients.

IL12A and IL12B polymorphisms and Hpylori associated diseases

Among the five IL12 genetic polymorphisms studied, and when considering the patients overall, no statistically significant association was found with the disease diagnosis. The patients were then subdivided into two main groups: those with non-cardia gastric cancer and those with benign diseases. Hpylori infection was more often recorded in non-cardia gastric cancer patients (69.4% v 49.0%) (Fisher’s exact test: p<0.01). On considering Hpylori infected patients only, non-cardia gastric cancer was correlated with cagA (Fisher’s exact test, p<0.05) and s1 vacA (Fisher’s exact test, p<0.05).

The frequency of non-cardia gastric cancer was higher in patients with the IL12A −504 T/T genotype (Fisher’s exact test, p<0.05) and in those with IL12B VNTR (TG-TA)9/(TG-TA)11 genotype (χ2 = 12.40, p<0.05) (fig 3).

Figure 3

 Association between non-cardia gastric cancer and IL12A −504 and IL12B variable number tandem repeat (VNTR) genotypes. We genotyped IL12B VNTRs by considering separately the most common alleles ((TG-TA)9 and (TG-TA)11) and combining all the remaining alleles as “others” (OTH). BD, benign diseases; NCGC, non-cardia gastric cancer.

Table 5 shows the association between IL12B VNTR polymorphism and the risk of gastric cancer. We selected subjects homozygous for the most common allele (TG-TA)11 as the reference group in the initial odds ratio estimations. The IL12B VNTR (TG-TA)9/(TG-TA)11 genotype was confirmed to increase the risk of gastric cancer, while (TG-TA)others/others was associated with a decreased risk of gastric cancer. When performing the logistic regression analysis considering the diagnosis of gastric adenocarcinoma as a dependent variable and the gene polymorphisms of IL12A −504, IL12B VNTR, and cagA as predictors, the odds ratios were 2.38 (95% CI, 0.96 to 5.88), 1.36 (1.05 to 1.76), and 1.68 (0.84 to 3.35), respectively. None of the IL12 gene polymorphisms studied was correlated with Lauren’s non-cardia gastric cancer classification.

Table 5

 Association between IL12B VNTR polymorphism and gastric cancer risk

In relation to patients with benign diseases, we analysed the association between the precancerous intestinal metaplasia and Hpylori infection, Hpylori virulence genes, and IL12 gene polymorphisms. Intestinal metaplasia was significantly correlated with Hpylori infection (χ2 = 10.05, p<0.01), cagA2 = 28.70, p<0.001), s1 vacA2 = 26.18, p<0.001), and with m1 vacA2 = 6.64, p<0.01), but not with IL12A or IL12B gene polymorphisms.


Using the DHPLC screening strategy followed by direct sequencing we identified the following polymorphisms: IL12A −504 T/G, IL12A +6686 A/G, and IL12B +15485 A/C. The first SNP was located in the promoter region of the IL12A gene, while the latter two were localised in the UTR regions of the two genes. These three polymorphisms were in Hardy Weinberg equilibrium. The two genes coding for the two IL12 subunits were also analysed for the number of dinucleotide repeats located in intron 6 and intron 4 for IL12A and IL12B, respectively. These VNTRs were studied bearing in mind that the amount of secreted protein might vary not only in relation to differences in the nucleotide sequence of the promoter or of the coding regions, but also in relation to intron VNTR, as already described for IL1RN,24 although the exact mechanism linking intron VNTR and protein synthesis has not yet been completely defined. The number of GT repeats of IL12A VNTR varied in our patients from a minimum of 11 to a maximum of 23, while TG-TA of IL12B ranged from eight to 13.

The wide range of the dinucleotide repeats for both VNTRs implies an excessive data dispersion whenever a statistical analysis is to be carried out. To overcome this limitation other investigators have classified the VNTR alleles of IL1RN on the basis of their length (long/short).29 This classification is feasible for IL1RN intron 2 VNTR, as each repeat corresponds to an oligonucleotide sequence of 86 bp, but it is difficult to apply to the present VNTRs as the maximum difference between the shorter and the longer alleles corresponds to only 24 bp. Therefore, in agreement with Cai et al,30 who studied the GT dinucleotide repeat polymorphism of the oestrogen receptor α gene, we classified the VNTR genotypes by considering the combinations of the most frequent alleles (three for IL12A and two for IL12B) and by grouping the less frequent alleles as “others”. Interestingly, significant associations were found between the VNTR genotypes and the SNPs of the corresponding gene. These associations might be the expression of linkage or of a selective advantage for some combinations over others.

None of the IL12A or IL12B polymorphisms and VNTRs studied was correlated with the presence or absence of Hpylori infection. We therefore suggest that the establishment of Hpylori infection depends on bacterial characteristics (urease production, expression of adhesins)1 more than on host cytokine gene polymorphisms, including IL12—although a role has suggested for TNFα –308 G to A transition.31 By contrast, cytokine gene polymorphisms may correlate with Hpylori virulence genes in Hpylori infected subjects. It has already been reported that TNFα polymorphisms are associated with infections from the more virulent cagA positive strains.31 In the present paper, another association was recorded: between cagA and the IL12A −504 T/G genotype. This finding may be explained on the basis that an association between cag PAI and IL12 has already been reported15,16: in infections caused by cagA positive strains, enhanced gastric mucosal transcription of IL12B is recorded, and enhanced release of IL12 by dendritic cells in vitro is found after exposure to cagE positive strains. IL12A −504 polymorphism might be involved in the regulation of gene expression and, consequently, of IL12 production. This nucleotide is contained within a site possibly recognised by the transcription factor AP2 (GCCTT/GGGG), with the penultimate base in our sequence being an A instead of a G.32 Using the program MATRIX SEARCH 1.0,33 which allows a search for potential transcription factor binding sites, the sequence with the G allele was recognised for AP2 binding with a match ratio of 0.74, the range which denotes lack of exact match being 0.0 to 1.0. With the T allele, no match was found. The AP2 transcription factor can, in turn, be induced by IL6,34 potently stimulated by Hpylori.11–13 The IL12A −504 T/G genotype was also correlated with gastritis activity, which is scored on the basis of the degree of infiltrating polymorphonuclear cells. This finding might either be spurious and consequent on the prevalence of cagA positive infecting strains recorded in patients with this genotype, or be the result of an enhanced release of IL12, which is known to stimulate the production by T cells and natural killer cells of GM-CSF.18

We also investigated whether there was any association between IL12A or IL12B polymorphisms and Hpylori associated diseases. After the patients had been subdivided into two groups—one consisting of those with non-cardia gastric cancer and the other of those with benign gastroduodenal diseases—non-cardia gastric cancer was found to be correlated with the IL12A −504 T/T genotype and with the IL12B VNTR (TG-TA)9/(TG-TA)11 genotype, but also with Hpylori infection and its virulence determinants, cagA and s1 vacA. For a better definition of the contribution of IL12 gene polymorphisms in enhancing non-cardia gastric cancer risk in Hpylori infected subjects, logistic regression analysis was undertaken and both cagA, IL12A −504 and IL12B VNTR polymorphisms were confirmed as risk factors for non-cardia gastric cancer. The onset of non-cardia gastric cancer can be considered the result of a process in which the complex interplay between Hpylori infection, host genetic background, and environmental factors creates conditions favouring or counteracting carcinogenesis.2,35,36 Taking into account the above hypotheses concerning the involvement of IL12A−504 SNP in the regulation of gene transcription, in T/T homozygote subjects the transcription factor AP2 should have a limited transcriptional effect on IL12A, and this might lead to reduced IL12 production. It is known that lack of IL12 production results in a reduction in host resistance to infections and tumours37,38 and that treatment with IL12 has a marked anti-tumour effect on mouse carcinomas.37 It is more difficult to interpret the association between IL12B VNTR (TG-TA)9/(TG-TA)11 and (TG-TA)others/(TG-TA)others genotypes and gastric cancer risk. Increasing numbers of intronic VNTRs have been found to interfere with transcription processes, either by their effect on secondary DNA structure, by their action as protein binding sites, or by their influence on the transcription or stability of mRNA.24,30 In addition, the VNTR polymorphism may be in linkage disequilibrium with exon alterations that may affect protein function.

Non-cardia gastric cancer, “intestinal-type” in particular, is the end stage of a series of lesions which apparently represent a continuum of changes from normal to carcinoma.39 These include, in order of increasing severity, chronic gastritis, chronic atrophic gastritis, intestinal metaplasia, and dysplasia. In agreement with the multistep process hypothesis, patients with intestinal metaplasia are at increased risk of non-cardia gastric cancer.40 We therefore looked for an association between the presence or absence of intestinal metaplasia and IL12 gene polymorphisms on the one hand, and Hpylori infection and its virulent determinants on the other. A strong correlation was found between intestinal metaplasia and Hpylori infection, cagA, and vacA. None of the host genetic IL12 gene polymorphisms studied was correlated with intestinal metaplasia. This indicates that they do not play a role in determining this histopathological alteration. The association between IL12 polymorphisms and gastric cancer risk, but not with intestinal metaplasia, suggests that this cytokine probably plays an important role in the progression of intestinal metaplasia to dysplasia and cancer. IL12 gene polymorphisms may act by allowing dysplastic cells, originated from a normal mucosa or from intestinal metaplasia, to escape immune surveillance. This concept is in agreement with the lack of any association between IL12 gene polymorphisms and non-cardia gastric cancer histological subtypes, which are thought to be associated (intestinal type) or not (diffuse type) with the precancerous intestinal metaplasia.39


IL12A and IL12B gene polymorphisms may affect the latest steps of gastric carcinogenesis in Hpylori infected subjects. The exact mechanism underlying this phenomenon has yet to be defined, although it is reasonable to suggest that IL12A −504 SNP and IL12B VNTR may modulate IL12 production in response to Hpylori infection.


We wish to thank Mrs Monica Razetti (Department of Laboratory Medicine, University Hospital of Padua, Padua, Italy) for her assistance in the Hpylori culture and DNA extractions.



  • Competing interests: none declared

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.