CASE REPORT

The proband, now 4 years old, was the first child born to African healthy unrelated parents. During pregnancy the mother presented threatened abortion and polydramnios. Antenatal ultrasound screening revealed oesophageal atresia and a single umbilical artery. The baby was delivered by elective caesarean section at the 35th week of gestational age. Birth weight was 2200 g (25th–50th centile). The diagnosis of oesophageal atresia was confirmed due to failure to pass a nasogastric tube into the stomach (the tube stopped 9 cm from the gingival margin) and through radiological studies of the upper oesophageal pouch (projection of end at level of D1–D2).

The absence of other congenital anomalies lead to classification of the newborn under the group A risk of the Waterston classification.²⁹ Surgical correction was performed in the 1st day of life. A right side transpleural thoracotomy was carried out, the distal tracheo-oesophageal fistula was closed, and a primary oesophageal anastomosis was performed. The anomaly was classified as a long gap oesophageal atresia with distal tracheo-oesophageal fistula (type 3 of the Roberts classification³⁰).

Postoperative course was complicated by gastro-oesophageal reflux irresponsive to medical therapy. A subsequent oesophago-gastro-duodenal endoscopy demonstrated low grade oesophagitis and an accessory pancreatic duct opening in the stomach. A fundoplication surgical procedure was carried out when the baby was 1 year old due to the presence of severe gastro-oesophageal reflux. At 3 year follow up the patient can eat without problems.

From a neurological point of view, the child presented a non-progressive encephalopathy, characterised by mild pyramidal and cerebellar signs (hyperreflexia, muscle hypotonia, and truncal ataxia), severe motor and mental retardation, and delayed visual maturation. During the 1st year of life prominent neurological signs were severe visual impairment and motor and cognitive delay, associated with mild muscle hypotonia and increased tendon reflex. At this time ophthalmologic examination was normal but visual evoked potentials were delayed and reduced in amplitude; brain MRI documented mild cerebral atrophy, without other malformations or abnormalities of visual pathways or of the posterior fossa. EEG revealed bursts of slow waves during wake and sleep; brainstem evoked potentials were normal; echocardiography was normal. The child’s psychomotor development has been characterised by very slow improvement of motor abilities (independent walking was achieved at 30 months), and by the acquisition of minimal cognitive and linguistic abilities. Basic visual functions (visual acuity, fixation, and visual pursuit) have progressively improved, while visual evoked potentials normalised by the age of 12 months, supporting the diagnosis of delayed visual maturation. The child is now 4 years old, and on neurological examination presents mild hyperreflexia, gross motor incoordination and gait ataxia, severe visual inattention, and mildly reduced visual acuity. Her mental age, measured using the Griffiths scale,³¹ is less than 1 year (severe mental retardation): she is able to recognise familiar persons, sometimes smiles in response to smiles, but does not usually attempt to interact with others. Some utterances are present, but she does not usually use words in a meaningful way and her expressive language is limited to a pre-speech level (crying and vocalising but no use of gesture or imitative behaviour). She shows no interest in toys. EEG, and visual and brainstem evoked potentials are within normal limits. The child has no skin abnormalities, and no problems with wound healing were reported.

METHODS

Cytogenetic characterisation

Routine cytogenetic analysis was performed on the proband’s blood using standard high-resolution techniques³² and DA-DAPI staining. Fluorescent in situ hybridisation (FISH) was done with a commercial (Vysis) mixture of probes including CEP 15 (D15Z1: 15p), SNRPN (15q11–q13), and PML (15q22) according to the supplier’s instructions and with PAC (P1 artificial chromosome) RP1-61B2 containing the gene BPAG1 (6p12.1: NCBI Map Viewer, http://www.ncbi.nlm.nih.gov; Santa Cruz Human Genome Browser, http://genome.cse.ucsc.edu/cgi-bin/hgGateway/; The Wellcome Trust Sanger Institute, http://www.sanger.ac.uk). The PAC was labelled with biotin-dUTP (Vector Laboratories, Burlingame, CA) using standard nick translation and visualised with FITC-avidin (Vector) and the chromosomes were counterstained with DAPI (Sigma Aldrich, Milan, Italy).

Parents’ karyotypes were analysed in G-banding.

Generation of somatic cell hybrids

The HPRT-negative RJK88 Chinese hamster cell line was maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Gibco). A lymphoblastoid cell line (LCL) was generated from the proband’s peripheral blood lymphocytes (PBL) with Epstein-Barr virus (EBV), and maintained in Roswell Park Memorial Institute (RPMI) medium supplemented with 10% FBS (Gibco). RJK88 cells were seeded at a concentration of 2×10⁷ cells per 100 mm tissue culture dish. After 24 h, cells were washed with DMEM without serum, and 5×10⁷ LCL cells were added in 5 ml of DMEM without serum containing 125 μl of a 1 mg/ml stock of phytohaemagglutinin-P (Sigma). Dishes were incubated at 37°C for 15 min. The media were gently aspirated, and 2 ml of 50% polyethylene glycol (1000 MW; Sigma) was layered over each dish. After 1 min treatment, cells were washed three times with DMEM and incubated in 10 ml of serum-free DMEM at 37°C for 30 min. Cells were allowed to recover overnight in 10 ml DMEM, 10% FBS. The next day cells from each 100 mm dish were trypsinised and seeded 1:5 into fresh 100 mm dishes containing selective media composed of DMEM with 10% FBS and a 1×solution of hypoxantine-aminopterin-thymidine (HAT; Sigma). Cells were fed fresh selection media every 2–3 days. After 2–3 weeks, individual colonies were transferred to a 24 well plate end expanded in duplicate 6 well plates. One well was used for genomic DNA isolation and genotyping, while the other was used for freezing of the clone. Clones were maintained in HAT media throughout the experiment.

DNA extraction and genotyping

Genomic DNA of the proband and her mother was extracted from venous blood using standard protocols. DNA from hybrid clones was extracted with Isoquick (Orca Research, Bothell, WA). Genotyping of polymorphic loci was performed by amplification with primers labelled with fluorescent probes (ABI 5-Fam, Hex, and Tet) followed by analysis on a ABI 310 Genetic Analyzer (Applied Biosystems). Non-polymorphic loci were assayed by electrophoresis on agarose gels. The UCSC Genome Browser (accessed June 2002) maps and sequence were used as references. Amplifications were performed with Taq Gold (Applied Biosystems) using standard protocols.

Inverse PCR was performed on RsaI cut, ligated (in 1 ml volume to facilitate self-ligation of individual fragments) genomic DNA, using nested sets of primers at different positions. Amplified fragments were isolated on a 1% agarose/TAE gel, purified with Qiaex II, and sequenced with a BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). Sequencing reactions were performed with a BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) and run on an ABI Prism 310 Genetic Analyzer.

RNA extraction and expression analysis

Total RNA was extracted from tissues and cell lines with Eurozol (Euroclone) following the manufacturer’s protocols, and human tissues total RNA was purchased from Clontech. cDNA synthesis was performed with Ready-To-Go You-Prime First strand beads (Amersham) and random hexamers. cDNA amplifications were performed in 25 μl reactions, using JumpStart Red ACCUTaq LA DNA polymerase (Sigma) and the following protocol: 1 min at 96°C, 30 cycles of 30 min at 94°C/2 min at 68°C, 5 min final elongation time. The primers for allele-specific expression analysis were hBPAG1 For (5′ TTCAAGTTCATGGACCTAAGGACT 3′), SNP-E35/1F (5′ CCGCTGAAAGAGAACTGGA 3′), and SNP-E35/1R (5′ CTGGAGGGCATTAAGTTCATA 3′); the primers for isoforms-specific amplification were hBPAG1 For, hBPAG1e Rev (5′ TTTCCTCCAACTGATTGCGAAAATTCAG 3′), hBPAG1 a Rev (5′ AATTAGGCGGTTTTCAGTTTGGGTAAGA 3′), and hBPAG1 b Rev (5′ ATGAGGCCTCTTAAAACTGCTTGAAAG 3′). Control human G3PDH primers were from Clontech. The cDNA for 5′ RACE was synthesised and amplified using a Smart RACE cDNA amplification kit (Clontech).

RESULTS

Cytogenetic and molecular characterisation

Cytogenetic analysis of the proposita revealed a reciprocal translocation interpreted as t(6;15)(p11.2;p12) (fig 1A). DA-DAPI staining showed that the 15p DA-DAPI positive region was still present on the der(15) (data not shown). FISH analysis confirmed the presence of satellite III DNA on the der(15) (fig 1B). Parents’ karyotypes were normal.

We screened 80 hybrid clones and found two containing a normal chromosome 6, two with a der(6), and one with a der(15). Genotyping the proband, her mother, and representative hybrid clones for polymorphic markers on both sides of the breakpoint (table 1) demonstrated that the translocation had taken place on the paternal chromosome. FISH analysis confirmed that the chromosome 6 breakpoint was within PAC RP1-61B2, which gives three signals localised at the normal chromosome 6 and at both derivatives, respectively (fig 1C).

Based on the UCSC map, we typed the informative hybrid clones for chromosome 6 markers and eventually restricted the breakpoint location to a 400 bp region about 2 kb downstream of the polyadenylation site of the BPAG1e isoform (fig 2A). The breakpoint was cloned by inverse PCR from the proband’s genomic DNA (fig 2B). There is no known feature on chromosome 6 that could be directly responsible for the translocation, except for an Alu repeat immediately flanking the breakpoint. All attempts to obtain additional chromosome 15 breakpoint sequence information by inverse PCR with other restriction enzymes failed.

The breakpoint does not disrupt the portion of BPAG1 coding for the epithelial isoform, but selectively interrupts the two longer isoforms recently demonstrated in the mouse.⁷

We sought to analyse whether the translocation also affects the expression of the epithelial isoform of the gene and searched for informative polymorphisms in its coding region. We found a heterozygous G/A polymorphism (dbSNP rs# cluster id: rs2230862, http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=snp) in the first of the two exons coding for the rod domain of the BPAG1e isoform, and determined the genotype of the alleles on the normal chromosome 6 (it carries the G allele) and the der(6) (it carries the A allele). Then we analysed the expression of the BPAG1e isoform in the proband’s LCL cells and hair roots (fig 3). We also analysed some heterozygous control subjects. The proband’s LCL amplifies BPAG1e cDNA about ten times more than the control LCL cells (fig 3A) and expresses exclusively the der(6) allele (fig 3B); hair roots express both alleles, although the allelic ratio varied between experiments, probably due to the small amount of RNA available.

Next, we analysed the expression of BPAG1 isoforms in a number of human tissues (fig 4A) using isoform-specific PCR (as in Leung 2001, modified for the human gene⁷). Sequence analysis of isoforms-specific amplification products and 5′RACE experiments (not shown) demonstrated that the alternative splicing pattern seen in the mouse BPAG1 gene is maintained in humans. BPAG1e is expressed in prostate and trachea; BPAG1a is expressed predominantly in brain and cerebellum, but also in prostate, testis, and trachea; BPAG1b is the only isoform found in lung and skeletal muscle, but is also expressed in brain, prostate, testis, and trachea. We also analysed the expression of BPAG1 isoforms in oesophagus samples from normal controls. All BPAG1 isoforms are expressed in normal oesophagus, while the oesophageal epithelium expresses mainly the e form (fig 4B).

DISCUSSION

The child we studied carries a de novo balanced translocation associated with oesophageal atresia and cognitive and motor delays.

Reciprocal translocations associated with Mendelian phenotypes have been instrumental in the identification of many disease genes.³³ Breakage of one or both chromosomes can cause loss of function phenotypes by disrupting the coding sequence of dosage-sensitive genes (see for example elastin and supravalvular aortic stenosis³⁴) or by separating the genes from the nearby regulatory sequences (see for example SOX9 and campomelic dwarfism³⁵). Alternatively, the translocation may cause gain of function phenotypes by switching the regulatory sequences from one gene to another, thus leading to inappropriate expression, or by producing a chimeric gene coding for a new chimeric protein. This is a common mechanism leading to tumour processes in leukaemias, lymphomas, and sarcomas (for a review see Rego and Pandolfi, 2002³⁶). In other cases one of the breakpoints of the chromosomes involved in the reciprocal translocation lose submicroscopic portions containing dosage-sensitive gene(s) (see for example SOX2 and anophthalmia³⁷). In our case, the abnormal phenotype of the proposita was presumably associated with the breakpoint on chromosome 6 since no protein-coding genes are present on the short arm of chromosome 15. The p-arms of human acrocentric chromosomes contain organised arrays of beta-satellite and D4Z4 repeats and rDNA. The beta-satellite and D4Z4 repeats appear at the distal end of the arm, while rDNA and D4Z4 repeats are interspersed at a more proximal location, corresponding to the p12.^38,39 The finding that at the chromosome 6 breakpoint the BPAG1 gene was interrupted resulting in the disruption of both brain- and muscle-specific isoforms suggests that BPAG1 haploinsufficiency may cause the patient’s clinical symptoms, or a truncated form of BPAG1 a/b could be expressed in tissues and interfere with the activity of the wild type protein, leading to a dominant negative phenotype. Of course, we cannot exclude that the maternal BPAG1 allele carries a mutation, leading to a recessive phenotype, or that the proband’s phenotype is unrelated to the translocation.

The genomic organisation of the human and mouse BPAG1 genes is very similar,^6,8 and our expression data on the three isoforms closely parallel those obtained in the mouse.

Dystonia musculorum (dt) is a recessively inherited neurodegenerative disease in mice, first visible between 7 and 10 days after birth. It develops as a progressive ataxia, due to the degeneration of the sensory neurons in the CNS.^2,4 The animals also show intrinsic muscle weakness and instability of skeletal muscle cytoarchitecture, as well as reduced resistance of stratified epithelia to mechanical stress.^25,26 In the dt/dt mouse, lack of BPAG1 probably induces a slow, initially subtle disorganisation of the developing neuronal cytoskeleton, eventually leading to disruption of the normal axioplasmic flow, resulting in focal swelling and neurodegeneration. Heterozygous mice apparently do not show any impairment. However, Bernier and colleagues⁴⁰ analysed the effects of dystonin mutations on Schwann cell structure and myelination of nerve fibres, and observed structural abnormalities and myelination defects. They also noted a gene dosage effect with heterozygous animals presenting hypo- and hyper-myelinated peripheral nerves.

The lack of one copy of BPAG1 or the presence of truncated forms of the protein could produce a subtler effect in humans on the same structures, perhaps leading to a partial disorganisation of the sensory and motor circuits. In our patient, the translocation is associated with a profound delay in the acquisition of cognitive and motor skills, as well as in visual maturation. No effects on epithelial tissues are visible, in agreement with the finding that the BPAG1 epithelial isoform is not disrupted by the translocation. When we tested allele-specific expression of the BPAG1e isoform in order to assess whether any position effect might prevent transcription of the der(6) allele, we could show that both alleles are expressed in the proband’s hair roots. Unexpectedly, proband’s LCL generated very high levels of BPAG1e amplification, apparently all from the der(6) allele. It is tempting to speculate that the unusual level of expression in LCL may be related to the presence on the der(6) chromosome of sequences from 15p. Our cytogenetic analysis has demonstrated that the 15p breakpoint is located in the band containing rDNA and D4Z4 repeats. D4Z4 repeats are involved in the genesis of facioscapulohumeral muscular dystrophy (FSHD), and numerous studies have demonstrated their role in chromatin structure control (reviewed in Bickmore and van der Maarel, 2003⁴¹), while rDNA localises to the nucleolus in interphase cells.

To our knowledge, the effects of repeated sequences from the human acrocentric chromosome short arms on the expression of a nearby gene have not been analysed in a naturally occurring translocation or in a reporter gene construct.

Could the translocation also have caused or facilitated oesophageal atresia (EA) in the proposita? Congenital EA occurs in about three of 10 000 live births^42,43 as a result of faulty development of the primitive foregut. In over 90% of such cases tracheo-oesophageal fistula is also present. Most cases are sporadic, but familial cases do exist (reviewed in Van Staey et al, 1984⁴⁴). One dominant form of EA, the oculo-digito-oesophageal-duodenal (ODED) syndrome, has been mapped to chromosome 2p23–24.⁴⁵ Non-syndromic EA is considered to be a multifactorial trait whose pathogenesis and causation are ill defined. The recurrence of EA in some families suggests a contribution of genetic factors. The association of EA with cognitive and motor delay in the absence of other congenital anomalies has not been specifically described.

We have shown that all three BPAG1 isoforms are expressed in the human adult trachea. BPAG1e is expressed in the epithelial layer of the oesophagus, while the whole tissue expresses all three isoforms.

BPAG1 expression in the developing digestive tract has never been analysed, and neither dt/dt nor BPAG1 KO mice show any obvious defects. On the other hand, there are data indicating a role for spectraplakins in organising morphogenetic events, such as the requirement for shot in the anastomosis of the developing tracheal tubules in Drosophila embryos,⁴⁶ or the alteration of F-actin organisation by plectin.⁴⁷

Genetic defects affecting the integrity of the basement membrane and hemidesmosomes can involve the digestive tract. This is the case in junctional epidermolysis bullosa with pyloric atresia (PA-JEB, MIM: 226730), an autosomal recessive disorder that can be caused by mutations in the integrin-beta-4 gene (ITGB4; MIM: 147557) and the integrin-alpha-6 gene (ITGA6; MIM: 147556). Association with oesophageal atresia has been reported in very few cases.^48,49

In view of the size of the BPAG1 gene and its exceptionally complex structure, mutational analysis in subjects with oesophageal atresia is hardly feasible, but immunohistochemical analysis of surgically removed tissues may be an option.

This study describes the first human subject with a specific disruption of the brain- and muscle-specific isoforms of BPAG1. The clinical picture of the patient is not easy to compare with the phenotype of the BPAG1-deficient mice, particularly in the absence of biochemical and histological data. Nevertheless, the pattern of expression of BPAG1 supports the hypothesis that the patient’s symptoms, and particularly her profound neurological impairment, are a direct consequence of the disruption of BPAG1 brain and muscle isoforms, leading to insufficient or inappropriate production of protein during embryogenesis.