METHODS AND RESULTS

We analysed 15 large families with XLMR linked to Xq24 according to the recent version of the Euro-MRX database. Cognitive impairment is the only common feature between patients of these families. We also studied a panel of 101 clinically well characterised small families with at least two boys affected with MR and 244 sporadic cases of non-specific MR. All patients were of European origin. CGG expansion involved in fragile X syndrome, assessed by Southern blot analysis using DNA digested with EcoRI/EagI restriction enzymes and StB12-3 probe corresponding to the FRAXA locus, as well as cytogenetic abnormalities, were excluded.

Genomic DNA was extracted from peripheral blood lymphocytes according to standard protocols and was used to amplify the coding exon and the flanking sequences of the AGTR2 gene. The coding exon of AGTR2 was amplified in two overlapping fragments 1 and 2. The two PCR products were 468 and 724 bp, respectively. Primer sequences were: AGTR21F 5′ gcataagaactaggagctg 3′; AGTR21R 5′ cagattggtacctatcaacac 3′ and AGTR22F 5′ ttatcacctgcatgagtgtt 3′; and AGTR22R 5′ agccatgttgattacatgca 3′. Reactions were performed in a volume of 50 μl containing 50 mmol/l Tris-HCl (pH 8.4), 1.5 mmol/l MgCl₂, 200 mmol/l of all four deoxynucleotides, 0.5 mmol/l each of the primers, 2.5 units of Taq polymerase (Platinum, Invitrogen), and 200 ng template DNA. Forty cycles were then performed with denaturation for 30 seconds at 94°C, annealing for 30 seconds at 54°C, and elongation for 30 seconds at 72°C. The DNA synthesis step of the final cycle was extended to seven minutes. For DHPLC analysis, the amplified DNA was then heated at 94°C for seven minutes, and at 55°C for four minutes to favour formation of heteroduplexes. Mutation analysis of the MR patients was performed by using denaturing high pressure liquid chromatography (DHPLC; Wave DNA fragment analysis system, DNASep column; Transgenomics). DHPLC conditions were chosen according to the Wavemaker program (Transgenomics, Santa Clara, CA, USA) (PCR product 1 59°C and 61°C; PCR product 2 59°C and 61°C). PCR products were subjected to chromatography using appropriate temperatures and acetonitrile gradients. PCR products were eluted with a linear acetonitrile gradient at a flow rate of 0.9 ml/minute, and those showing an abnormal DHPLC profile were directly sequenced on an automated sequencer (ABI 377, Perkin-Elmer) using the Dye Terminator method. To limit the false negative results, 20 familial cases were also screened for mutations by direct sequencing of two PCR products covering the whole coding region of AGTR2.

Both DHPLC and direct sequencing methods allowed the detection in two mentally retarded male patients of the R248K (G>A 742) mutation which was described previously as a polymorphism.⁴ In addition, we also identified a novel G to T transversion in exon 3 of the AGTR2 gene resulting in a C117F amino acid substitution in one patient (fig 1). This patient is an affected subject of a large four generation family with mental retardation, isolated growth hormone deficiency, and infantile behaviour but without other consistent phenotypic features. This family has already been described clinically by Hamel et al.¹² To determine if the novel missense mutation was the cause of mental retardation in this patient, his relatives were analysed. Ninety-nine subjects including seven affected patients were analysed for this variation. Although no unaffected subjects (including five males) had the sequence variation, two affected patients did not carry the C117F mutation.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1

Fluorescence sequence analysis of exon 3 of the AGTR2 gene. The arrow indicates the position of the C117F mutation.

DISCUSSION

The lines of evidence supporting the pathogenic role of C117F are its low frequency, its absence in 100 normal chromosomes from normal male subjects, and its conserved position in the amino acid sequence of human, rat, mouse, Oryctolagus, and Meriones. This amino acid at position 117 is located in the first extracellular loop of the AGTR2 receptor which belongs to the seven transmembrane (TM) domain G protein coupled receptor subfamily. Surprisingly, by using BLAST programs, we identified the motif including the cysteine at position 117 in a family of human G protein coupled receptor related to the growth hormone (GH) secretagogue and neurotensin receptors (GPR38 and GPR39).¹³ In these GH secretagogue receptors, the cysteine is located in the TM3 domain. The overall conservation of critical amino acid residues in the TM domains of the puffer fish (puffer fish clone 78B7) and human receptors is remarkable given the 400 million years of evolution that separates these two species. TM3 appears to be essential for binding and activation of ligands. These TM3 residues are hypothesised to form part of the binding pocket and to make contact with the ligand.¹⁴ These findings suggest that the cysteine at position 117 in the receptor plays an important role in the binding of the ligand(s) of AGTR2.

However, these features are not sufficient to define this amino acid change as the disease causing mutation. To determine if the novel missense mutation was the cause of mental retardation in this patient, his relatives were analysed. Although no unaffected subjects (including five males) had the sequence variation, two affected patients did not carry the C117F mutation, which rules out the involvement of AGTR2 in the aetiology of the phenotype of the patient. Nevertheless, as an adult, one of these two patients with no C117F mutation was the tallest member of the family (1.59 m in height) and had the highest concentration of somatomedin C (10.3 nmol/l).¹² Therefore, we cannot completely rule out that this sequence variation modulates stature. However, recently an in frame duplication of 33 bp encoding for an additional tract of 11 alanines within the transcription factor SOX3 was identified in all affected members of this family, suggesting that dysfunction of the SOX 3 protein is the primary cause of the mental retardation in this family.¹⁵

Our report clearly shows the importance of genotyping parental and grandparental DNA to avoid misleading interpretations. In addition, the ethnic origin of the patients should be considered in reporting nucleotide changes and a suitable control population should be investigated for the presence of the corresponding variation. Our findings highlight the need for extreme caution in the clinical interpretation of sequence variation in the AGTR2 gene, especially when these are missense mutations that fall outside well characterised functional domains. Up to now, only three missense mutations have been described in males with mental retardation. The G21V mutation is located within the extracellular domain and the missense mutations R324Q and I337V are localised in the intracellular domain of the AGTR2 protein.⁴

In contrast to the previous report that identified eight mutations out of 590 patients with mental retardation, no deleterious mutation was detected in our study.⁴ This suggests that AGTR2 is rarely involved in non-specific mental retardation but could be involved in specific forms which should be better delineated in the future.