MATERIAL AND METHODS

Our study population consisted of 45 SRS patients in whom diagnosis was ascertained according to Wollmann et al⁷ and in whom cytogenetic abnormalities and uniparental disomy 7 have been excluded. Fifty-eight healthy probands of German origin were investigated as controls.

DNA was isolated from blood samples by a simple salting out procedure and photometric measuring of DNA was performed on a Gene Quant II (Pharmacia). DNA was diluted in water to a concentration of 20 ng/μl and stored at room temperature overnight before use.

Information on the genomic structure of the C7orf10 gene was obtained by performing a BLAST search in public databases with the cDNA AK021870⁶ as a probe. Thereby, we identified the chromosome 7 working draft sequence segment gi18567765 containing the C7orf10 gene.

This information was used to choose intronic primers for the amplification of the 15 exons and the intron-exon boundaries of the C7orf10 gene by standard PCR.⁸ Primer information and PCR conditions are listed in table 1. In the case of exon 1, standard PCR conditions were changed in that 1.5 mmol/l MgCl₂ was replaced by 1.5 mmol/l MgSO₄. Additionally, the PCR enhancer system (2×) provided by Invitrogen was used. For amplification of exons 2 and 6, 5% formamide was added to the mixture. Fragment sizes were between 200–300 bp. Analysis of these fragments was performed by SSCP as published previously.⁸ Unusual SSCA patterns were directly sequenced using the BigDye Termination Sequencing Kit (Applied Biosystems).

To analyse genomic duplications or deletions in the C7orf10 gene, we used a TaqMan assay approach. Probe and primers were designed using the PrimerExpress™ software (Applied Biosystems, Weiterstadt). We designed a TaqMan probe specific for exon 14 of C7orf10, since in this fragment we did not detect any variants which might influence the amplification efficiency. This exon is localised proximally to the breakpoint in the SRS patients reported by Monk et al⁵ and Nakabayashi et al.⁶ The TaqMan probe (probe c7orf10-Ex14 tggcctcgttatggagatggagcatc, primers: c7orf10-Ex14T-F gttttgccttttcaggtattacaca, c7orf10-Ex14T-R acggaaatcttccccacagtt) contained a FAM reporter dye connected to the 5′ end. Probes and primers were purchased from Operon. As a reference locus, we used exon 3 of FVIII; primer and probe information was published by Wilke et al.⁹

PCR was carried out using an ABI Prism 7000 sequence detection system and 96 well MicroAmp optical plates. PCR was performed as described previously.¹⁰ All reactions of the same run were prepared from the same master mix. Each well of the 96 well plate contained either 50 ng of sample DNA, or 125 ng, 25 ng, or 5 ng of standard DNA, respectively. Each test sample and each amount of standard DNA was amplified in two different wells. Reactions for the C7orf10 test locus and the FVIII reference locus were prepared and run in parallel.

Data evaluation was carried out using the ABI7000SDS software as described by Wilke et al.⁹ Separate standard curves were generated for the test and the reference loci. Using these curves, the starting gene copy number relative to the reference subject were determined for each well, and the mean of the relative starting gene copy number values in different wells was calculated for each test sample and each locus. For males, the absolute copy number of the SMN1 test locus per haploid genomic equivalent was calculated by the ratio of the means of the relative starting copy numbers of the test locus and the FVIII reference locus. For females, this ratio was multiplied by a factor of 2.

RESULTS AND DISCUSSION

Several reports on chromosomal and molecular findings in SRS patients suggest that a genomic rearrangement in the short arm of chromosome 7 is involved in SRS. Since C7orf10 is disrupted by chromosomal breakages in 7p in at least two SRS patients, this factor is an attractive candidate for SRS.

We therefore screened our SRS patients for mutations of the coding region as well as for duplications/deletions. By SSCP analysis, we detected two abnormal patterns in exons 8 and 15 of the C7orf10 coding sequence. In the case of exon 8, a G>A transition at cDNA position 652 was detected, representing a silent mutation (L243L). In the first SSCP fragment of exon 15, we detected a C>G transversion at cDNA position 1217, corresponding to the published SNP rs1053953. Both variants were detected in similar frequencies in SRS patients and controls (table 2). In addition, we detected the previously published SNPs rs699484 at nucleotide position 1772165 and rs1053953 at position 1772000.

Using a real time PCR approach, we excluded duplications or deletions of exon 14 of the C7orf10 gene: the ratio of C7orf10/FVIII ranged between 0.8 and 1.3 in both patients and controls, corresponding to a copy number of two.

On the whole, our results do not indicate a relevant role of C7orf10 in the aetiology of SRS. Of course, we cannot exclude that mutations in C7orf10 are present in a relatively small number of SRS cases, since SRS is heterogeneous. However, multiple studies suggest that several loci on chromosome 7 and other chromosomes could be involved in SRS.¹ It is possible that SRS is a contiguous gene syndrome or the result of mutations in several components of one metabolic pathway resulting in the same phenotype, as suggested for the GH/IGF axis.¹¹

With respect to the SRS candidate region in 7p, more than 90 SRS patients have been screened for duplications and genomic rearrangements,^5,12,13 but no evidence for a central role of duplications in 7p was obtained. The patients in these studies were screened by microsatellites, fluorescence in situ hybridisation (FISH), or quantitative approaches aimed at certain genes or regions, that is, the genes for GRB10, IGFBP1, and IGFBP3. Since these fragments span a large chromosomal region, cryptic duplications or deletions between these regions might remain undetected.