Materials and methods

PATIENT

The XX male patient investigated in this study is Japanese and has been described previously.10 11 There was no family history of mental illness. He married but has no children. He was admitted to hospital with a diagnosis of schizophrenia but showed little response to neuroleptic medication. After a second admission, he remained in hospital for 30 years with chronic delusions. He was of dull normal intelligence (full scale WAIS 72, verbal IQ 68, performance IQ 75) with blunted affect. His symptoms satisfy the DSM-III-R criteria for the diagnosis of schizophrenia. Cytogenetic studies showed a 46,XX karyotype. No family history of psychosis was noted and no material was available from other family members.

CELL LINE

Lymphocytes from the patient transformed with Epstein Barr virus (EBV) were the source of genomic DNA and of metaphase chromosomes. The transformed cells were cultured in RPM1640 medium supplemented with 10% fetal calf serum (FCS).

EXTRACTION OF GENOMIC DNA

DNA was extracted from transformed lymphocytes using Genomix kits (Talent/VH Bio, Newcastle Upon Tyne, UK) according to the manufacturer's instructions. DNA obtained from the blood of normal Japanese males and females served as controls.

PCR AMPLIFICATION OF SEQUENCE TAGGED SITES (STS)

Twenty μl reactions containing 100 ng of genomic DNA, 12 pmol of each primer, 0.2 mmol/l of each dNTP, 0.4 U ofTaq polymerase (Promega Inc), and 1 × PCR buffer (Promega Inc) were amplified using a thermocycler (Genetic Research Instrument) as follows. After an initial denaturation step at 94°C for five minutes, samples were subjected to 35 cycles for 30 seconds at 94°C, 30 seconds at 55°C, one minute at 72°C, followed by a final step for 10 minutes at 72°C. The annealing temperature varied depending on the Tm of the primers. Products were analysed by electrophoresis on 1-2% agarose gels.

DNA SEQUENCING

PCR amplification of STSs were scaled up two to threefold and the products were purified using Qiaquick PCR purification kits (Qiagen Ltd, UK). The purified products were sequenced using dye terminator cycle sequencing (Big Dye sequencing system, Applied Biosystems Inc) and were analysed by an ABI 373 sequencer (Applied Biosystems Inc). Sequencing of the cloned 3 kb Yp/Xp junction fragment was carried out in a stepwise manner by primer extension initiated from both T7 and Sp6 ends of the cloning vector.

BAC AND PAC CLONES

BAC clones derived from the Yp region homologous to Xq21.3 were gifts from Dr Gareth Howell (Sanger Centre). PAC clones were isolated from the RPCI-1 library (available through the HGMP resource centre, Hinxton) by screening with X/Y homologous STS primer pairs.18-20

Transformed bacteria were cultured in L-broth containing chloramphenicol or kanamycin as appropriate and DNA was extracted using an alkaline lysis method.21 Clones were tested for the presence of STSs to confirm that they were authentic. DNA from clones selected for in situ hybridisation were purified using Qiagen Midi columns (Qiagen Ltd, UK).

PCR PRIMERS

Primers for amplification of STSs have been described previously.18-20 Other primers were as follows: J: 5′ CAGCAACATGTATTGAAA ATAC; M: 5′ TCTGCTGCCTGCCCCTGA; N: 5′GGCAGCATTGCCGCAAAC; O: 5′AGTCAGAGTAATGAGGCCTCTC; P: 5′ GAGAAGAAAGAATGGGGAGGAT; AC: 5′ CTATGACTGGACGTGCACATAG. AP: 5′ TCCCTATATCTCCCGTGT; AR 5′ ACGTGCGAACTGGTACAT.

Primers J and M are Y specific at their 3′ ends. They were designed by comparing the sequence of the relevant part of Yp (from PAC clone dJ145K17 and GenBank entry AC012077) with the Xq21.3 homologous sequence (AL121823 from the Sanger Centre). Primers N, O, and P were designed from the Yp sequence. Forward (F) and reverse (R) primers for amplifying the fragment spanning the Tsp509I restriction enzyme sites in Yp were 5′ACTGTCTTCTCCCCAATGAA and 5′ GTGATTGGGTCAAAGTGGCT, respectively.

INVERSE PCR

Five μg amounts of genomic DNA from the XX male, a normal Japanese male, and a normal Japanese female were digested to completion with BamHI at 37°C overnight. The digested DNA was extracted with phenol/chloroform, chloroform, precipitated with ethanol in the presence of 0.3 mol/l sodium acetate, and resuspended in water. A total of 200 ng of digested DNA were self-ligated overnight at 4°C in a 40 μl reaction containing 1 × ligase buffer (Promega) and 0.15 U T4 ligase (Gibco). Ligated preparations were denatured at 94°C for five minutes and quenched on ice before use in PCR reactions. Approximately 20 ng of ligated DNA were the templates for the first round of inverse PCR using the Extensor High Fidelity PCR kit (Advanced Biotechnologies), according to the manufacturer's instructions. Fifty μl reactions containing 1 × buffer 1, 350 μmol/l of each dNTP, 1.75 mmol/l MgCl₂, and 2 U ofTaq polymerase were subjected to 35 cycles of amplification. Cycling parameters were as follows: an initial denaturation step at 94°C for two minutes, followed by 35 cycles of 94°C for 15 seconds, 66°C for 30 seconds, 68°C for five minutes, and a final extension step at 72°C for five minutes.

Primers J and P were used for the first round of inverse PCR and a secondary PCR was carried out with primers J and O essentially as above using 1/10 dilution of the first PCR reaction products as template.

CLONING OF THE Yp/Xp JUNCTION FRAGMENT

Inverse PCR products were cloned using the pGEM TA cloning kit (Promega) according to the manufacturer's instructions.

FLUORESCENCE IN SITU HYBRIDISATION (FISH)

BAC and PAC clones containing relevant STS markers were selected for FISH analysis. Total BAC and PAC DNA was labelled with biotin by nick translation (Biotin-nick translation kit, Boehringer Mannheim). Metaphase chromosomes from the patient and normal controls were hybridised to biotin labelled DNA and bound DNA was shown using fluorescently labelled antibiotin antibody according to standard protocols.22

ANALYSIS OF MICROSATELLITE MARKERS

To refine the breakpoint in Xp22.3, the number of alleles of a variety of microsatellite markers mapping in Xp22.3 was estimated in the XX male and normal Japanese male and female DNA. Genomic DNA was amplified through PCR using the relevant primers as described in the Genbank and Genethon databases. One of each pair of primers was labelled with cy5 and the PCR products were analysed in a denaturing polyacrylamide sequencing gel using the Alf Express sequencer (Pharmacia).

RADIATION HYBRID MAPPING

The STS BPX, developed from the X specific region of the breakpoint junction fragment (primers AP and AR), was mapped using the Genebridge 4 radiation hybrid panel (HGMP Resource Centre, Hinxton). The pattern of positive and negative hybrids was converted to a data vector and submitted tohttp://www.sanger.ac.uk/Software/RHserver//RHserver.shtml for two point RHMAP analysis with framework markers. The Genemap99 at the Genbank web page http://www.ncbi.nlm.nih.gov/genemap99/map.cgi?CHR=Xwas consulted to identify the map location of these markers. Vectors for the highest scoring framework markers and their neighbours were retrieved from EBI athttp://corba.ebi.ac.uk/RHdb/species/HUMAN/gm98.html and reanalysed with the BPX vector to position BPX within the radiation hybrid map.

Results

MAPPING THE BREAKPOINT ON THE Y CHROMOSOME

Since previous studies had indicated that the breakpoint mapped in the region of Yp11.2 homologous to Xq21.3 (fig 1), further mapping of its location required an approach that could discriminate between homologous sequences derived from X and Y chromosomes. Initial PCR analysis confirmed that the SRY marker was present in the XX male, the marker DXYS156 showed the Y specific polymorphism, and the Y specific STSs sY58 and sY78 which map outside the X-Y homology region were not present (not shown). Further experiments involved sequencing STSs in the genomes of the XX male patient and normal Japanese males and females. The method depends on the capacity to detect heterozygosity and assumes that the PCR conditions can amplify both X and Y derived STSs efficiently. In the case of GMGXY6, Y specific primers gave amplification with only the normal male and the XX male (not shown).

• Download figure
• Open in new tab
• Download powerpoint

Figure 1

(A) Schematic illustration (not to scale) of X and Y chromosomes showing the regions involved in the transposition. The 3.5 Mb Xq21.3/Yp11.2 region of homology comprising STS markers sY20 to GXY5 is indicated (black box). Grey box represents the pseudoautosomal regions (PAR1) of X and Y. Dark grey box indicates the male specific gene SRY. (B) Map of Yp showing selected STS markers within the 3.5 Mb region homologous to Xq21.3.23 Arrow indicates the location of the breakpoint (Bkpt) between 13d and sY42 markers in the abnormal paternal X chromosome of the XX male with psychosis. GMGXY4, GMGXY5, GMGXY6, GMGXY9, and GMGXY12 have been abbreviated. (C) Enlargement of part of Yp11.2 showing the location of BAC and PAC clones used for FISH.  

The results of analysis of 22 STSs within the X-Y homology region are summarised in table 1 and fig 1. A number of cases were uninformative because there were no differences between males and females. The most proximal Y marker present was GMGXY6Y, and the first confirmed deleted marker was the Y homologue of 13d. The distance between GMGXY6Y and 13d is approximately 500 kb. To localise the breakpoint within this region further, PAC and BAC clones selected for the intervening non-informative STSs were used in FISH.

FLUORESCENCE IN SITU HYBRIDISATION (FISH)

The results of in situ hybridisation obtained with the XX male chromosomes are shown in fig 2. The BAC clone BA32K15 (fig 1) containing sY41 and sY42 hybridised to the Xq region of both X chromosomes (arrows 1 and 2 in fig 2A) but also to a second site at the telomeric end of the abnormal X chromosome (arrow 1). Similar results were obtained using the PAC clone dJ145K17, which spans the sY42, 13d, and 2450L markers. However, in this case, the signal in the abnormal Xp (arrow 1, fig 2B) was fainter than in Xq indicating that only part of this sequence was present on the telomere of the abnormal X chromosome. Finally, the BAC clone BA240N18, which is centromeric to 13d and contains STS 2450L, hybridised to Xq of both chromosomes but not to Xp (fig 2C). These results, together with the STS analysis discussed above, confirm that the breakpoint on Yp lies between the markers sY42 and 13d.

• Download figure
• Open in new tab
• Download powerpoint

Figure 2

Results of FISH with clones BA32K15 (A), dJ145K17 (B), and BA240N18 (C) on metaphase chromosomes of the XX male. Arrows 1 and 2 indicate abnormal paternal X chromosome and normal maternal chromosome respectively. Four yellow dots on the abnormal chromosome in (A, arrow 1) show that sY41-sY42 sequences are present in the terminal part of Xp as well as Xq, whereas the normal chromosome (A, arrow 2) shows only two dots in Xq. Fainter dots in Xp compared to Xq in (B, arrow 1) indicate that only part of the sequence between markers sY42 and 2450L was translocated to Xp. Absence of dots in Xp in (C) indicate that the sequence translocated to Xp did not include the marker 2450L.

FINE MAPPING OF THE BREAKPOINT BY RESTRICTION ENZYME ANALYSIS AND Y SPECIFIC PCR

To map the breakpoint further, we exploited differences between the sequences of Xq21.3 and Yp11.2 in the region spanning 13d and sY42 to design Y specific primers and primers that amplify fragments containing restriction enzyme (RE) sites which differentiate between X and Y. Primers F/R (fig 3B) were designed to amplify a region containing an RE site difference between the X and Y chromosomes. Digestion of PCR product from X derived DNA withTsp509I is expected to produce two fragments of 161 bp and 23 bp, respectively, whereas only one 184 bp fragment is expected from Y derived DNA. Fig 4A shows the results of aTsp509I digestion of PCR products from the patient and controls indicating that the XX male had Y derived sequence in this region. We further showed that the Y specific primer M (1940 bp from 13d) (fig 3) and primer N (1816 bp from 13d) amplified a product of expected size (124 bp) using normal Japanese male DNA as template, but failed to amplify products using normal Japanese female DNA or the XX male DNA as templates (fig 4B). We concluded therefore that the breakpoint mapped within the region defined by the X specificTsp509I RE site and primer M.

• Download figure
• Open in new tab
• Download powerpoint

Figure 3

(A) Sketch of part of Yp showing the location of primers and the relevant restriction enzyme Tsp509I (Tsp) sites (not to scale). (B) Sketch of the Yp/Xp junction showing the location of the breakpoint, relevant Tsp509I (Tsp) sites, and primers J and AC which were used to amplify a unique fragment in the XX male. Note presence of two Tsp509I RE sites 184 bp apart in Yp within the sequence flanked by F and R primers.

• Download figure
• Open in new tab
• Download powerpoint

Figure 4

(A) Results of Tsp509I digestion of PCR product obtained with primers F and R (see fig 3) showing that the XX male patient has a male genotype at this point. (B) Results of a PCR with primers M and N (see fig 3) showing amplification of the expected size product (124 bp) from a normal Japanese male but not from a normal Japanese female or the XX male. Since primer M is Y specific at its 3′ end, the results indicate that the XX male does not have Yp derived sequence at this point. (C) Results of a PCR with primers J and O (see fig 3) showing amplification of a unique major 3 kb band in the XX male. This is the secondary PCR subsequent to inverse PCR with primers J and P. (D1). Results of a PCR showing that primers J and AC amplify a fragment of expected size (800 bp) in the XX male but not in normal Japanese males and females. This confirms that the fragment is unique and spans the Yp/Xp junction in the XX male. (D2) Results of a PCR using sY46 primers as a control confirmed that all three genomic DNAs could be amplified and generated the expected 200 bp product.

THE JUNCTION FRAGMENT

Inverse PCR and cloning of the Yp-Xp junction fragment

To isolate the junction between Yp and Xp, nested inverse PCR was performed. Genomic DNA was digested withBamHI, religated at low concentration, and used as template for inverse PCR. Primer locations are indicated in fig3. Primers J (designed to be Y specific at its 3′ end) and primer P were used for the first round of PCR and primers J and O for the secondary PCR. The results of the secondary PCR with primers J and O are shown in fig 4C. A major unique fragment (approximately 3 kb) was obtained from the XX male DNA but not from normal Japanese male and female DNA. This fragment was gel purified and cloned. Ten recombinant clones with an insert of expected size were sequenced from both ends. Three clones contained the expected ends as shown by the presence of primers J and O in the sequence and a BamHI site at the expected distance from primer O.

The complete sequence of the junction fragment from one of the clones (clone 10) is shown in fig 5. The sequence 3′ of the J primer contains nucleotides (position 23-339 inclusive) present in Yp11.2 but not in Xq21.3, that is, the sequence is 100% Y derived. From position 551 onward, there are a number of single or double nucleotides which are neither Xq21.3 nor Yp11.2 derived. We believe that this indicates the presence of Xp derived sequences. Consequently, the breakpoint on the Y chromosome has occurred within the region 340-550 bp. This is consistent with and extends our independent data (fig 4A) which indicated a difference in a RE site forTsp509I in the XX male that also occurred in the Yp sequence, but not the sequence from Xq21.3. Thus, fig 5 shows the sequence GATT at position 223 in the XX male, also found in Yp11.2, whereas the Xq21.3 derived sequence has theTsp509I RE site AATT at this point. This is also consistent with results shown in fig 4B which showed the absence of Y specific sequence at the primer M site in the XX male. Thus, at position 665, the XX male sequence has a G instead of A at the 3′ end of the primer and a C instead of G at the fourth nucleotide from its 5′ end. Primer O is at the expected distance from theBamHI site (deduced from the sequence of Yp).

• Download figure
• Open in new tab
• Download powerpoint

Figure 5

Multiple alignment of part of the sequence of the 3 kb Yp/Xp junction fragment and homologous sequences in Yp11.2 and Xq21.3 showing that the XX male has 100% Y specific sequences for the first 339 bases but the sequence differs from Xq21.3 and Yp sequences from position 551. We expect the sequences from position 551 onwards to be Xp22.3 derived. The breakpoint is estimated to be within the region 340-550 (bold and underlined). The sequence of the rest of the junction fragment extending from 1001 to 2974 is shown in the lower part of the figure. A CpG island consisting of 13 CpG (bold) is underlined. Sequences which do not contain LTR repeats (underlined and italics) were used to design primers AP/AR for radiation hybrid mapping. PCR primers, the BamHI RE site, and relevant Tsp509I RE sites are indicated. The filled circle indicates loss of a Tsp509I RE site in Yp11.2 and in the XX male DNA. The sequence of the junction fragment extending from primer J to the BamHI RE site has been submitted to EMBL (Accession number AJ309278).  

To confirm that the cloned fragment indeed spanned the Yp-Xp junction, a PCR was carried out using primer J and primer AC which is located within the putative Xp region. Fig 4D1 shows that a product of expected size (800 bp) was amplified using the XX male genomic DNA as template but not normal Japanese male and female DNA controls. The results show that the fragment is a unique sequence present only in the XX male. A second set of primers confirmed this result (not shown). A control for the DNA template amplification is shown in fig 4D2.

Analysis of the sequence of the junction fragment

Most of the 2975 bp sequence consists of LTR and LINE repeats. Clearly these must have been involved in the abnormal recombination between Yp and Xp during meiosis, forming the abnormal paternal X of the XX male patient. Since these repeats share extensive sequence identity, it is difficult to map the breakpoint exactly. However, it was possible to identify LTR sequences which contained nucleotides present in Yp but not Xq21.3 and nucleotides that were neither Yp nor Xq21.3 derived. Part of the sequence (which did not consist entirely of repeat elements) contained 14 CpG dinucleotides in a 270 bp region which showed 97% identity with a CpG island sequence (Genbank Accession Z57539). This is of interest since it suggests that there could be genes in Xp downstream of the breakpoint that might be affected by the Yp translocation.

To date we have not found convincing identity between the sequence 3′ of the breakpoint and sequences in Xp as a whole or Xp22.3 in particular. However, sequencing of this region by the Human Genome Project is not yet complete. Database searches for identity are further complicated because of the presence of LTR repeat sequences in many chromosomes.

MAPPING THE BREAKPOINT ON THE X CHROMOSOME

Microsatellite markers

In an attempt to map the breakpoint on Xp22.3, we analysed the number of alleles for microsatellite markers in the genome of the patient. The results showed that the patient has two alleles for DXS6807 indicating that the breakpoint is distal to this marker. Analysis of markers DXS1233, DXS7100, DXS1060, DXS987, and the PAR1 markers DXYS228 and DXYS233 were uninformative. Fig 6 shows the chromosome rearrangement and the position of the breakpoints in this patient relative to markers, genes, and previously described structural abnormalities of Xp22.3.

• Download figure
• Open in new tab
• Download powerpoint

Figure 6

Ideogram showing illegitimate recombination between Yp11.2 (black box) and Xp22.33 (grey box) during paternal meiosis resulting in an abnormal paternal X in the XX male patient. The breakpoint is between sY42 and 13d markers in Yp11.2 and distal to ASMT in Xp22.33. The region comprising the genes XG to ASMT and probably also ASMTL is duplicated in the abnormal paternal X and therefore triplicated in diploid cells of the patient. Grey box represents the pseudoautosomal regions (PAR1) of X and Y. Dark grey box indicates the male specific SRY gene. Black box indicates Xq21.3/Yp11.2 homology region. Unfilled box shows part of Xp22.3 proximal to PAR1. Relevant markers and genes are indicated. ASMT: acetylserotonin N-methyltransferase. ASMTL: acetylserotonin N-methyltransferase-like. STS: steroid sulphatase deficiency. SS: SHOX short stature gene. KAL: Kallmann syndrome gene. Other genes MIC2 and XG are indicated.

Radiation hybrid mapping

The STS BPX was used to amplify the Genebridge 4 radiation hybrid panel. The expected product size (862 bp) was amplified from the human control DNA but not from the mouse and hamster DNA. The positive and negative results of the hybrid amplifications were converted to a vector and submitted to the Sanger Centre web site for two point RHMAP analysis. Lod scores of 20.9 and 16.5 were obtained for the framework markers AFMa284xc9 and AFMb290xg5, respectively. Based on the Genebridge 4 radiation hybrid map, Genemap99, both framework markers are located in PAR1 with AFMa284xc9 being more distal. The Genebridge 4 vectors for these framework markers and their neighbouring markers (stSG28551, sts-F04211, stSG38742, stSG3076, stSG15779, stSG25747, stSG21520) were extracted from the EBI database. Analysis of these vectors positioned BPX between AFMa284xc9 (DXYS233) and AFMb290xg5 (DXYS228), with an identical vector to the markers stSG28551 and sts-F04211 acetylserotonin N-methyltransferase-like (ASMTL) but distal to acetylserotonin N-methyltransferase (ASMT) (fig6).

Discussion

The paternal X of our patient was the result of abnormal recombination between Xp and Yp during male meiosis in an extensive region of retroviral LTR repeats. These particular repeats are in low abundance in the genome and at least 95% identical between loci on Xp and Yp. Approximately 4 Mb of Yp, includingSRY, were translocated to Xp22.33 on the abnormal X chromosome. Single/double nucleotide differences between the X and Y in the region of X-Y homology were exploited to determine the origin of STS markers in the XX male by sequencing and restriction enzyme analysis. These differences also allowed the design of primers for Y specific PCR and inverse PCR, leading to the cloning and sequencing of the translocation junction fragment. We were thus able to map the breakpoint on Yp to within a 210 bp interval (between sY42 and 13d) and develop a new STS (BPX) from the putative Xp22.33 derived sequence. The Yp breakpoint lies within 180 kb of repeats comprising various LTR and LINE elements, with no genes yet described within the immediate vicinity. The Xp22.33 STS BPX was mapped to PAR1 between framework markers DXYS233 and DXYS228 using the Genebridge 4 radiation hybrid mapping panel. Fine mapping positioned BPX close toASMTL and distal toASMT.

This is the second patient to be characterised with a translocation between Yp sequences in the Xq21.3/Yp homology block and the Xp PAR1. In the case described previously,17 the Yp breakpoint was defined just telomeric to DXYS5 within the Xq21.3/Yp homology block, and the Xp breakpoint distal to DXYS28. Thus, this patient17 has a smaller contribution from Yp, but an additional 1 Mb from the X chromosome. Both cases are atypical of (Y+) XX males, as they have triplication of PAR1 genes, and in this respect are similar to people with sex chromosome aneuploidies (XXX and XXY). In contrast to Klinefelter (XXY) syndrome, our patient, like other XX males, has stature within the normal female range. Triplication including PAR1 was also found in one subject bearing an isodicentric chromosome derived from Yp24 with mental retardation and in a male patient with a duplication of distal Xp25 with autism who also had severe mental retardation. In contrast, an atypical XXY subject has been described with a partial deletion of the short arm of one X chromosome26 without cognitive impairment. These case reports are consistent with the hypothesis that triplication of genes in the proximal part of PAR1 (ASMT,MIC2R, MIC2,XG, possiblyASMTL, and any as yet unknown genes) increases the risk of cognitive impairment. However, the cognitive impairment in our patient is somewhat more severe than is generally seen in Klinefelter syndrome in which it is mild and selective to verbal ability.4 The relationship of cognitive function to genes in PAR1 therefore remains unclear.

An increased prevalence (two to threefold) of schizophrenia in Klinefelter syndrome (47, XXY), 47,XXX, and 47,XYY3 27and an increased incidence of sex chromosome aneuploidies in some populations with psychosis would support the involvement of gene dosage from regions of homology between the sex chromosomes in psychosis.28 The patient reported in this study has two regions of the sex chromosome homology triplicated, the proximal part of the PAR1 and the distal part of the Yp11.2/Xq21.3 homology block. The largest class of Y(+) XX males is the result of illegitimate recombination in hot spots involving the PRKX/PRKY genes.15 16 The breakpoints in these patients involve the transfer of material from the short arm of the Y chromosome including the Yp block of Xq21.3/Yp11.2 homology to the abnormal X chromosome. There is no evidence of an increased incidence of psychosis in such patients. Therefore, it is unlikely that additional copies of genes normally found in the Xq21.3/Yp11.2 homology block contribute directly to a psychotic phenotype. Although it is possible that triplication of proximal PAR1 gene(s) contributes to psychosis in this patient, the fact that most subjects with supernumerary sex chromosomes do not suffer from psychosis reflects a more complex pathogenesis.

The chromosomal rearrangement in the XX male may affect gene expression in a number of ways. First, increased gene dosage may lead to an abnormally high level of the triplicated gene products, for example, in PAR1 as noted. Second, the rearrangement may disrupt genes or affect expression through a position effect caused by the juxtapositioning of X and Y chromosome material. This could lead to either an up or downregulation of PAR1 or transferred Yp genes. Third, the rearrangement may alter any established imprint or X inactivation status of PAR1 or Yp genes. Investigation of these possibilities in this patient may indicate which of the triplicated loci are most likely to be involved in the phenotype.