Materials and methods

Peripheral blood was taken from 400 patients with autosomal dominant disorders seen at genetic clinics at Moorfields Eye Hospital. The diagnoses in these patients included retinitis pigmentosa (200 patients), cone (20) and cone-rod (80) dystrophy, and macular dystrophies (100). These patients were diagnosed as having an autosomal dominant mode of inheritance since one parent was known to have been affected. Peripheral blood was also collected from 50 unrelated normal subjects to act as normal controls. These controls were spouses of the patients and have been clinically examined; they are from the same ethnic background as the patients and are of a similar age.

Genomic DNA was extracted using the Nucleon II extraction kit (Scotlab Bioscience). This DNA was used to perform mutation analysis by polymerase chain reactions (PCR) as described below.

HETERODUPLEX ANALYSIS

Genomic DNA was amplified using primers that allowed amplification of the complete coding region ofGCAP2. The primer sequences are as follows: (forward/reverse, 5′-3′) GUCA1B exon 1, tcaggcctcctggaaagg/ccaggtggactggccactggtc (305 bp), exon 2, gagaagccctgtgtttgcagg/cttgtggccaaccttcagagc (303 bp), exon 3, ggaagtggtgctgggggatg/ggacgtgcggccagaaagtgg (272 bp), exon 4, catcctgggagcgaggtctctc/gagccaggaccctcctactac (281 bp). Annealing temperature for all primers was 58°C. The PCR reaction buffer contained 50 mmol/l KCl, 10 mmol/l Tris-HCl (pH 8.3), 1.5 mmol/l MgCl₂, 0.01% (w/v) gelatin, 160 μmol/l of each primer, and 0.5 U Taq DNA polymerase (Promega). The amplified exons were analysed by electrophoresis using MDE gel run at 180 V overnight using Hoeffer 600S apparatus.13

DIRECT SEQUENCING

Products of PCR amplification were sequenced using the PRISM^TM Ready Reaction Sequencing Kit (Perkin Elmer Cetus) and the products were analysed on an ABI 373 automated sequencer. All PCR products were sequenced in the forward and reverse directions.

Results

Heteroduplexes were seen in DNA from patients in exons 1, 3, and 4. These PCR products were sequenced to determine the nucleotide changes in these patients.

EXON 1

The change was identified as a T to C nucleotide change that resulted in a third base pair substitution giving a silent polymorphism leaving the tyrosine residue 57 unchanged. This polymorphism has been identified in approximately 35% of our normal and diseased populations.

EXON 3

Three changes were observed in this exon. The first was a 1 bp intronic insertion −22 bp from the 3′ splice site of exon 3. This is predicted not to affect the correct splicing of this exon, and indeed the insertion did not segregate with disease in the pedigree. The insertion was only seen in one patient of the 400 affected subjects and in none of our controls, which suggests a rare sequence variation. The second change seen in six of our patients was a single nucleotide substitution G to A in the intron 9 bp from the 3′ splice site of this exon; again this is not predicted to alter splicing. The third change seen in two patients was a GAG to GAT change at codon 155. This results in a conservative change of glutamic acid to aspartic acid. The Glu is within the EF4 hand predicted calcium binding site of the molecule and is conserved in the human and bovine amino acid sequences. However, the change still conforms to the consensus sequence for EF hands.8 In addition, this change and the others seen in exon 3 were also detected in our normal controls.

EXON 4

Three changes were observed in the affected group. The first was a 7 bp intronic insertion −59 bp from the 5′ splice site of exon 4. The insertion was only seen in two patients in this group and in none of our controls, suggesting that it is a rare sequence variation. The second change seen in 10 of the affected group was a single nucleotide A to G substitution in the intron 30 bp from the 5′ splice site of this exon. The third change was again a single base pair change C to G in the intron 34 bp from the 3′ splice site of exon 4. These changes would not be expected to affect correct splicing of this exon and were observed in controls.

These results are shown in table 1.

Discussion

The results of this study did not show any evidence that GCAP2 was involved in the pathogenesis of autosomal dominant retinal degeneration in this group of patients. In addition, the changes detected were considered to be sequence variations or polymorphisms and not disease causing.

The biochemical studies on GCAP2 show that it is less effective than GCAP1 at stimulating RetGC-1 suggesting that it plays a lesser role in photoreceptor recovery than GCAP1. GCAP2 has, however, been shown to have a unique role in stimulating RetGC-2 (structurally similar to RetGC-1 and also found in the retina) in vitro. Both GCAP2 and RetGC-2 have an as yet undefined function in the retina, neither being part of the phototransduction pathway.7 RetGC-2 (located on chromosome Xq22) has been screened for mutations in patients with X linked retinal degenerations and to date no mutations have been reported.14

At present a pathogenic role for GCAP2 in autosomal dominant retinal degenerative disease cannot be excluded since there are examples of disease causing genes producing degenerative phenotypes in single families, such as the alpha subunit of transducin (GNAT1) causing CSNB in a single French family,15 and GUCA1A causing cone dystrophy in a British family.10 GCAP2 has yet to be investigated as a cause of recessive retinal degeneration; however, no families with recessive disease have been mapped to 6p21.1. While mutations in GCAP2 do seem not to be a common cause of retinal degeneration in our population, they should be considered as a possible cause of degeneration in families linked to the 6p21.1 region.