You are here

Article Text

Article menu

Download PDFPDF

Mutation report
NARP syndrome in a patient harbouring an insertion in the MT-ATP6 gene that results in a truncated protein
  1. E López-Gallardo1,2,3,
  2. A Solano1,
  3. M D Herrero-Martín1,2,3,
  4. Í Martínez-Romero1,2,3,
  5. M D Castaño-Pérez4,
  6. A L Andreu2,5,
  7. A Herrera6,
  8. M J López-Pérez1,2,3,
  9. E Ruiz-Pesini1,2,3,7,
  10. J Montoya1,2,3
  1. 1
    Departamento de Bioquímica, Biología Molecular y Celular, Universidad de Zaragoza, 50013-Zaragoza, Spain
  2. 2
    CIBER de Enfermedades Raras (CIBERER), ISCIII, Spain
  3. 3
    Instituto Aragonés de Ciencias de la Salud, Spain
  4. 4
    Servicio de Neurología. Hospital Virgen de los Lirios, Alcoy, Alicante, Spain
  5. 5
    Hospital Vall d’Hebron, Barcelona, Spain
  6. 6
    Servicio de Cirugía Ortopédica y Traumatología, Hospital Miguel Servet, Zaragoza, Spain
  7. 7
    Fundación Aragón I+D (ARAID), Spain
  1. Professor J Montoya. Departamento de Bioquímica, Biología Molecular y Celular, Universidad de Zaragoza, Miguel Servet 177, 50013-Zaragoza, Spain; jmontoya{at}unizar.es

Abstract

Background: Neurogenic muscle weakness, ataxia and retinitis pigmentosa (NARP) syndrome have been associated to m.8993T>G/C mutations in the subunit 6 of the ATP synthase (p.MT-ATP6).

Methods: We have performed a mutational screening of the mitochondrial DNA gene encoding for this protein in 62 patients with the disease, that do not carry any of the common mutations described to date.

Results: We report clinical and molecular data in one patient who harbours a de novo insertion in the MT-ATP6 gene that results in a truncated subunit. The mutation was heteroplasmic (85%) in muscle DNA and the BN-PAGE analysis showed a clear decrease in the amount of ATP synthase.

Conclusion: Molecular analysis of NARP patients cannot be limited to the search of the m.8993T>G/C and either the ATP6 or the whole mtDNA should be sequenced.

https://doi.org/10.1136/jmg.2008.060616

Statistics from Altmetric.com

    Request Permissions

    If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

    Maternally inherited Leigh (MILS) and neurogenic muscle weakness, ataxia and retinitis pigmentosa (NARP) syndromes have been associated to m.8993T>G/C mutations in the subunit 6 of the ATP synthase (p.MT-ATP6).1–4 Although not always fulfilling this rule, it is currently thought that the mutational load marks the difference between both phenotypes (MILS/NARP).5 Heteroplasmy level higher that 90% of the mutant mitochondrial DNA (mtDNA) tends to result in MILS. Below this percentage, the phenotype usually presents as a NARP syndrome. Many other genetic variants have been associated with MILS, such as other mutations in MT-ATP6 or in other mtDNA encoded protein or tRNA genes (http://www.mitomap.org). Nuclear mutations in structural proteins from several electron transport chain (ETC) complexes, mutations in oxidative phosphorylation (OXPHOS) complex assembly proteins, or even in proteins not directly related with the OXPHOS system, have also been associated with Leigh syndrome.6 However, in addition to the m.8993T>G/C, only one other mutation, m.9185T>C, has been reported for NARP.7 In this article we describe a patient with a de novo insertion in the MT-ATP6 gene that results in a truncated p.MT-ATP6 protein.

    PATIENT AND METHODS

    Case report

    The patient’s mother signed a written informed consent form. The patient, a 40-year-old male, was born at the end of a normal pregnancy. He has no family history of neurological disease and his two siblings are normal. At age 4 years, the patient showed slight signs of developmental delay, which were even more pronounced at age 5, when the patient showed signs of psychomotor retardation and irritability. At age 12, the patient presented with several episodes characterised by loss of consciousness and clonic spasms. Additional signs of neurological involvement were cephalea, bilateral hearing loss, blindness, ataxia, and cramps.

    Current neurological examination shows a patient with short stature and psychomotor retardation (Wechsler Adult Intelligence Scale (WAIS) test showed an IQ of 58). Blood test showed a normal haematological and biochemical profile. X ray examination, echocardiogram, electrocardiogram, and abdominal echography were all normal. Otologic examination revealed a progressive neurosensorial hypoacusia, and fundoscopic studies revealed the presence of bilateral optic atrophy and bilateral slight retinal pigmentation with normal electroretinogram, suggesting a clinical diagnosis of retinitis pigmentosa.

    Skeletal muscle biopsy showed no alterations other than a slight variation in the size of fibres with normal histochemical analysis. Ragged red fibres (RRF) were not observed. Nerve conduction studies showed an axonal polysensorial neuropathy with no spontaneous activities of myopathic units. Magnetic resonance imaging showed cerebellar atrophy with dilatation of the fourth ventricle and diffuse cortical atrophy as well as hyperintensity of basal ganglia and diffuse hyperintensities of white matter (fig 1). Spectroscopy findings were consistent with lactate accumulation.

    Figure 1
    Figure 1 Brain magnetic resonance imaging showing (A) cortical and severe cerebellar atrophy, as well as (B) hyperintensities in right basal ganglia.

    Samples from patients and controls were obtained according to the Helsinki Declaration and the ethics committee of the hospital. All persons included in this study gave their informed consent.

    Molecular-genetic analysis

    The MT-ATP6 gene from the patients was screened by conformation sensitive gel electrophoresis (CSGE) and subsequent sequencing of the fragments containing a mutation.8

    The amount of mutated molecules was studied by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis, using HmtL8335 (ATTAAGAGAACCAACACCTC) and HmtH9187 (AGAGGCTTACTAGAAGTGTG) primers. The amplicon size is 853 bp and the PCR conditions 94°C 2 min (94°C 30 s/56°C 30 s/72°C 1 min 30 s) 35 cycles 72°C 5 min. After 35 PCR cycles, 2 μCi of [α−32P] dCTP (3000 Ci/mmol) was added and one additional cycle was performed. The restriction enzyme MboI (/GATC) digests the amplicon in four fragments of 459, 257, 113 and 24 bp. The presence of the mutation eliminated one restriction site, thus generating only three fragments of 459, 257 and 137 bp.

    OXPHOS complexes analysis

    Proteins from an enriched mitochondrial fraction were separated by tricine SDS–PAGE on 10% polyacrylamide gels9 and the OXPHOS complexes were separated by blue-native polyacrylamide gel electrophoresis (BN-PAGE) as previously described,10 with some modifications. The gradient gel was 5–13% acrylamide:bisacylamide (48:1.5) and the cathode buffer A (50 mM tricine, 7.5 mM imidazole, Serva Blue G-250 0.002%, pH 7.0) and cathode buffer B (50 mM tricine, 7.5 mM imidazole, pH 7.0) were used. Samples were slowly electrophoresed, 100 V for 1 h, until they entered the stacking gel. Then, the voltage was increased to 500 V for 5 h.

    After the electrophoresis, the proteins were electroblotted onto PVDF filters and sequentially probed with specific antibodies against complex V (anti-ATPase a antibody and anti α-F1-ATPase11), complex IV (anti-subunit I, Molecular Probes), complex III (anti-core 2, Molecular Probes), complex II (anti-Fp, 70 kDa subunit, Molecular Probes, Eugene, Oregon, USA) and complex I (anti-β−subcomplex subunit, Molecular Probes) and detected by the “SuperSignal West Pico Mouse IgG Detection Kit” from Pierce (Rockford, Illinois, USA).

    ATPase activity was developed in native gels as described previously.12

    RESULTS

    We performed a large screening of the m.8993T>G/C mutations in 62 patients with a clinical phenotype consistent with NARP. Only two of them were positive for these mutations. Then, we performed an MT-ATP6 gene mutational screening by using CSGE in 60 individuals negative for those pathologic mutations. Only one patient showed a band pattern (heteroduplex) consistent with a heteroplasmic mutation in blood sample (fig 2A). The patient did not present depletion or deletions of the mtDNA. We sequenced the MT-ATP6 gene from muscle and blood and found a thymidine insertion after nucleotide position 8618 (m.8618-8619insT) (fig 2B). This insertion was not found in more than 2950 MT-ATP6 sequences (www.mitomap.org). We confirmed that we were not amplifying nuclear pseudogenes by using a rho0 cell line as a control (not shown) and by checking the mutation in a pseudogen database before quantifying the mutational load.13 Then, we designed a last cycle radioactive PCR-RFLP analysis and found a 26% and 85% mutational load in the patient’s blood and muscle, respectively (fig 2C). However, the mutation was not present in blood from his brother, mother or maternal aunt. Thus, the mutation segregated with the phenotype at individual and tissue levels.

    Figure 2
    Figure 2 Mitochondrial genetic analysis of the m.8618-8619insT. (A) CSGE analysis of a segment of the MT-ATP6 gene of a blood sample from the patient (C, control; P, patient; HE, heteroduplexes; HO, homoduplexes). (B) Electropherogram of the DNA fragment showing the m.8618-8619insT. CB, control blood; PB, patient blood; PM, patient muscle. (C) Pedigree and mutational load in different tissues of the patient determined after autoradiography of fragments obtained by last cycle radioactive PCR-RFLP amplification, to avoid detection of heteroduplexes. The restriction enzyme MboI (/GATC) digests the amplicon in four fragments of 459, 257, 113 and 24 bp. The presence of the m.8618-8619insT eliminated one restriction site, thus generating only three fragments of 459, 257 and 137 bp. B, blood; M, muscle.

    The m.8618-8619insT mutation produces a frameshift affecting the next 31 amino acids before producing a stop codon. Thus, the new p.MT-ATP6 subunit contains 63 amino acid residues instead of the 227 of the normal protein (fig 3).

    Figure 3
    Figure 3 Partial nucleotide and amino acid sequences of the MT-ATP6 gene and p.MT-ATP6 protein in a control and in the patient. In the mtDNA sequence, the T insertion and the stop codons are indicated in red and the new amino acids after the frameshift in blue. Numbering of the amino acids starts at the point of the insertion.

    A Western blot analysis showed a decrease in the levels of the muscle p.MT-ATP6 subunit (fig 4A), but the truncated protein was not visible in the gel (not shown). Therefore, very likely, the truncated protein is lost in the electrophoresis, is quickly degraded, or the antibody is not able to recognise this fragment of the protein. However, the Western blot showed that the subunit α from complex V and particular subunits from other respiratory complexes were apparently normal (fig 4A). Similar to other MT-ATP6 mutations, these results strongly indicate that proliferation of mitochondria is absent in muscle in this syndrome, supported by the absence of RRFs.14 To study how the amount of p.MT-ATP6 affected the levels of complex V, we performed a BN-PAGE and found a clear decrease in the amount of ATP synthase, while the levels of the respiratory complexes III and IV were apparently normal (fig 4B,C). We also found two major complex V subcomplexes when the membrane was overexposed (fig 4D). These subcomplexes have been previously defined as F1 and F1c15 and they contain the matrix arm of ATP synthase or this arm plus membrane subunits c, respectively. Gel analysis of the ATPase activity confirmed these results (fig 4E).

    Figure 4
    Figure 4 OXPHOS (oxidative phosphorylation) complexes analysis of the patient and control samples. (A) Western blot analysis of subunits from all the OXPHOS complexes. (B) BN-PAGE analysis of OXPHOS complexes stained with Coomassie blue (right panel) or silver (left panel). PM, patient muscle; CM, control muscle (sex and age matched control); MK, molecular weight marker. (C) BN-PAGE/Western blot analysis. PM, patient muscle; CM1 and CM2, control muscle 1 (sex and age matched control) and 2, respectively. (D) Overexposed BN-PAGE/Western blot from the membrane shown in upper part of panel C. SC1 and SC2 indicate ATP synthase subcomplexes 1 and 2, respectively; DEL, muscle sample from a patient with 80% of the 4977 bp mtDNA deletion including the MT-ATP6 gene. (E) In gel analysis of the ATPase activity. Abbreviations as in panels B and D.

    To develop a model to study the phenotypic expression of this mutant, we tried to produce transmitochondrial cybrids using platelets from the patient. We repeated the fusions three times but, surprisingly, cells always died between days 3 and 4 of the selection period, although parallel fusions with platelets from other mitochondrial genotypes were successful.

    DISCUSSION

    To our knowledge, this is the first animal truncated p.MT-ATP6 described. However, there are many yeast strains with mutations that produce a truncated p.MT-ATP616 as well as genetically engineered yeast strains17 and bacteria18 lacking this gene. In yeast, the absence of the MT-ATP6 gene provokes a dramatic decrease in the levels of the p.MT-COI subunit. This is not apparently happening in our patient (fig 4A). Thus, it is possible that the remaining 15% of the wild type MT-ATP6 in our patient is sufficient enough to reach normal levels of p.MT-COI synthesis or the interactions between these two complexes are different in these two organisms. MtDNA instability is another feature associated with yeast truncated p.MT-ATP6 subunits, but again our patient did not show mtDNA depletion or deletions.

    The results presented here strongly support the proposal that de novo mutation m.8618-8619insT has a major role in the expression of the patient’s phenotype. This mutation seems to have common trends with other ATP synthase related mutations, the most remarkable being the presence of central nervous system involvement and lack of myopathy, like all the eight reported MT-ATP6 point mutations that are associated with MILS, NARP, familial bilateral striatal necrosis, and Leber’s hereditary optic neuropathy (www.mitomap.org). The number of MT-ATP6 mutations associated with NARP syndrome is very low.19 Thus, other mutations in the mtDNA20 or nDNA genes are probably the aetiologic factors for most of the NARP patients. Therefore, the molecular analysis of NARP patients cannot be limited to the search of the m.8993T>G/C and either the ATP6 or the whole mtDNA should be sequenced.

    Acknowledgments

    We would like to thank Dr Godinot for the kind gift of the anti-α-F1-ATPase and anti-ATP6-F0-ATPase antibodies. We also thank Magdalena Carreras and Santiago Morales for all their help in the laboratory.

    REFERENCES

    1. ↵
      1. Holt IJ,
      2. Harding AE,
      3. Petty RK,
      4. Morgan-Hughes JA
      . A new mitochondrial disease associated with mitochondrial DNA heteroplasmy. Am J Hum Genet 1990;46:428–33.
      OpenUrlPubMedWeb of Science
      1. Shoffner JM,
      2. Fernhoff PM,
      3. Krawiecki NS,
      4. Caplan DB,
      5. Holt PJ,
      6. Koontz DA,
      7. Takei Y,
      8. Newman NJ,
      9. Ortiz RG,
      10. Polak M,
      11. Ballinger SW,
      12. Lott MT,
      13. Wallace DC
      . Subacute necrotizing encephalopathy: oxidative phosphorylation defects and the ATPase 6 point mutation. Neurology 1992;42:2168–74.
      OpenUrlAbstract/FREE Full Text
      1. de Vries DD,
      2. van Engelen BG,
      3. Gabreels FJ,
      4. Ruitenbeek W,
      5. van Oost BA
      . A second missense mutation in the mitochondrial ATPase 6 gene in Leigh’s syndrome. Ann Neurol 1993;34:410–2.
      OpenUrlCrossRefPubMedWeb of Science
    4. ↵
      1. Sciacco M,
      2. Prelle A,
      3. D’Adda E,
      4. Lamperti C,
      5. Bordoni A,
      6. Rango M,
      7. Crimi M,
      8. Comi GP,
      9. Bresolin N,
      10. Moggio M
      . Familial mtDNA T8993C transition causing both the NARP and the MILS phenotype in the same generation. A morphological, genetic and spectroscopic study. J Neurol 2003;250:1498–500.
      OpenUrlCrossRefPubMedWeb of Science
    5. ↵
      1. Tatuch Y,
      2. Christodoulou J,
      3. Feigenbaum A,
      4. Clarke JT,
      5. Wherret J,
      6. Smith C,
      7. Rudd N,
      8. Petrova-Benedict R,
      9. Robinson BH
      . Heteroplasmic mtDNA mutation (T−G) at 8993 can cause Leigh disease when the percentage of abnormal mtDNA is high. Am J Hum Genet 1992;50:852–8.
      OpenUrlPubMedWeb of Science
    6. ↵
      1. Ruiz-Pesini E,
      2. Lopez-Gallardo E,
      3. Dahmani Y,
      4. Herrero MD,
      5. Solano A,
      6. Diez-Sanchez C,
      7. Lopez-Perez M,
      8. Montoya J
      . [Diseases of the human mitochondrial oxidative phosphorylation system]. Rev Neurol 2006;43:416–24.
      OpenUrlPubMed
    7. ↵
      1. Childs AM,
      2. Hutchin T,
      3. Pysden K,
      4. Highet L,
      5. Bamford J,
      6. Livingston J,
      7. Crow YJ
      . Variable phenotype including Leigh syndrome with a 9185T>C mutation in the MTATP6 gene. Neuropediatrics 2007;38:313–6.
      OpenUrlCrossRefPubMed
    8. ↵
      1. Ganguly A,
      2. Rock MJ,
      3. Prockop DJ
      . Conformation-sensitive gel electrophoresis for rapid detection of single-base differences in double-stranded PCR products and DNA fragments: evidence for solvent-induced bends in DNA heteroduplexes. Proc Natl Acad Sci U S A 1993;90:10325–9.
      OpenUrlAbstract/FREE Full Text
    9. ↵
      1. Schagger H,
      2. von Jagow G
      . Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem 1987;166:368–79.
      OpenUrlCrossRefPubMedWeb of Science
    10. ↵
      1. Herrero-Martín M,
      2. Pineda M,
      3. Briones P,
      4. López-Gallardo E,
      5. Carreras M,
      6. Benac M,
      7. Idoate M,
      8. Vilaseca M,
      9. Artuch R,
      10. López-Pérez M,
      11. Ruiz-Pesini E,
      12. Montoya J
      . A new pathologic mitochondrial DNA mutation in the cytochrome oxidase subunit I. Hum Mutat 2008;29:e112–22.
      OpenUrlCrossRefPubMed
    11. ↵
      1. Moradi-Ameli M,
      2. Godinot C
      . Characterization of monoclonal antibodies against mitochondrial F1-ATPase. Proc Natl Acad Sci U S A 1983;80:6167–71.
      OpenUrlAbstract/FREE Full Text
    12. ↵
      1. Grandier-Vazeille X,
      2. Guerin M
      . Separation by blue native and colorless native polyacrylamide gel electrophoresis of the oxidative phosphorylation complexes of yeast mitochondria solubilized by different detergents: specific staining of the different complexes. Anal Biochem 1996;242:248–54.
      OpenUrlCrossRefPubMed
    13. ↵
      1. Mishmar D,
      2. Ruiz-Pesini E,
      3. Brandon M,
      4. Wallace DC
      . Mitochondrial DNA-like sequences in the nucleus (NUMTs): insights into our African origins and the mechanism of foreign DNA integration. Hum Mutat 2004;23:125–33.
      OpenUrlCrossRefPubMedWeb of Science
    14. ↵
      1. De Vivo DC
      . The expanding clinical spectrum of mitochondrial diseases. Brain Dev 1993;15:1–22.
      OpenUrlCrossRefPubMedWeb of Science
    15. ↵
      1. Carrozzo R,
      2. Wittig I,
      3. Santorelli FM,
      4. Bertini E,
      5. Hofmann S,
      6. Brandt U,
      7. Schagger H
      . Subcomplexes of human ATP synthase mark mitochondrial biosynthesis disorders. Ann Neurol 2006;59:265–75.
      OpenUrlCrossRefPubMedWeb of Science
    16. ↵
      1. John UP,
      2. Willson TA,
      3. Linnane AW,
      4. Nagley P
      . Biogenesis of mitochondria: DNA sequence analysis of mit- mutations in the mitochondrial oli2 gene coding for mitochondrial ATPase subunit 6 in Saccharomyces cerevisiae. Nucleic Acids Res 1986;14:7437–51.
      OpenUrlAbstract/FREE Full Text
    17. ↵
      1. Rak M,
      2. Tetaud E,
      3. Godard F,
      4. Sagot I,
      5. Salin B,
      6. Duvezin-Caubet S,
      7. Slonimski PP,
      8. Rytka J,
      9. di Rago JP
      . Yeast cells lacking the mitochondrial gene encoding the ATP synthase subunit 6 exhibit a selective loss of complex IV and unusual mitochondrial morphology. J Biol Chem 2007;282:10853–64.
      OpenUrlAbstract/FREE Full Text
    18. ↵
      1. Ono S,
      2. Sone N,
      3. Yoshida M,
      4. Suzuki T
      . ATP synthase that lacks F0a-subunit: isolation, properties, and indication of F0b2-subunits as an anchor rail of a rotating c-ring. J Biol Chem 2004;279:33409–12.
      OpenUrlAbstract/FREE Full Text
    19. ↵
      1. Marotta R,
      2. Chin J,
      3. Quigley A,
      4. Katsabanis S,
      5. Kapsa R,
      6. Byrne E,
      7. Collins S
      . Diagnostic screening of mitochondrial DNA mutations in Australian adults 1990–2001. Intern Med J 2004;34:10–9.
      OpenUrlCrossRefPubMed
    20. ↵
      1. Jonckheere A,
      2. Hogeveen M,
      3. Nijtmans L,
      4. van den Brand M,
      5. Janssen A,
      6. Diepstra H,
      7. van den Brandt F,
      8. van den Heuvel L,
      9. Hol F,
      10. Hofste T,
      11. Kapusta L,
      12. Dillmann U,
      13. Shamdeen M,
      14. Smeitink J,
      15. Rodenburg R
      . A novel mitochondrial ATP8 (MT-ATP8) gene mutation in a patient with apical hypertrophic cardiomyopathy and neuropathy. J Med Genet 200845:129–33.

    Footnotes

    • Funding: This project was supported by grants from Instituto de Salud Carlos III-FIS (PI07-0045, PI07/90512), Diputación General de Aragón (Grupos Consolidados B33). MDH-M and IM-R are supported by a predoctoral fellowships FIS (FI05/00501 and FI0700184). The CIBER de Enfermedades Raras is an initiative of the ISCIII.

    • Competing interests: None.

    • Patient consent: Obtained.

    • AS present address: Centro de Investigación Príncipe Felipe, Valencia, Spain