Primers for PCR amplification of MBL2 fragments
| Primer* | Accession number | Nucleotide sequence (5′→3′) | Primer concentration | Annealing temperature | PCR product length |
|---|---|---|---|---|---|
| *The number preceding the decimal point refers to the nucleotide position of the Genbank DNA sequence of the specified accession number given in the neighbouring column, which also corresponds to the 5′ nucleotide of the oligonucleotide. The annotations.5 and.3 refer to forward and reverse primers, respectively. | |||||
| 47.5 | AF080508 | CAACGTAGTAAGAAATTTCCAGAG | 0.4 μM | 57°C | 913 bp |
| 959.3 | AF080508 | CCAGGCAGTTTCCTCTGGAAGG | 0.4 μM | ||
| 621.5 | AF080508 | ACCCAGATTGTAGGACAGAG | 0.1 μM | 55°C | 339 bp |
| 959.3 | AF080508 | CCAGGCAGTTTCCTCTGGAAGG | 0.1 μM | ||