Region | Primer sets1-150 | Mutation | Restriction endonuclease | Restriction fragments (bp)1-151 | |||||
---|---|---|---|---|---|---|---|---|---|
Normal | Mutant | ||||||||
I | TLF62028-TLR62320 | IVS-1 nt 5 | Cac8I | 293 | 257,36 | ||||
IVS-1 nt1 | BslI | 29,22,22,175,45 | 29,22,22,220 | ||||||
Codon 26 | MnlI | 12,37,106,16,60,62 | 12,37,106,16,122 | ||||||
Codon 15 | SfcI | 293 | 202,91 | ||||||
Codon 17 | BfaI | 24,114,155 | 24,114,72,83 | ||||||
Codon 19 | MaeII | 218,75 | 293 | ||||||
Codon 30 | Bsp1286I | 167,126 | 167,83,43 | ||||||
IVS-1 nt2 | Cac8I | 293 | 250,43 | ||||||
II | TLF62392-TLR62703 | Codon 41/42 | TaqI | 312 | 263,49 |
↵1-150 The primers used were: TLF62028-5′ACCTCACCCTGTGGAGCCAC3′ (common C in Old et al 3); TLR62320-5′CTATTGGTCTCCTTAAACCTGTCTTGTAACCTTGCTA3′; TLF62392-5′TATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTT GGACCCAGAGGTC3′; TLR62703-5′ CCCCTTCCTAT GACATGAACTTAA 3′; modifications in nucleotide sequence are indicated by bold letters.
↵1-151 Bold numbers indicate fragments of distinguishable sizes.