Table 1

PCR primers and restriction endonucleases used in the detection procedure

RegionPrimer sets1-150MutationRestriction endonucleaseRestriction fragments (bp)1-151
NormalMutant
ITLF62028-TLR62320IVS-1 nt 5 Cac8I 293 257,36
IVS-1 nt1 BslI29,22,22,175,45 29,22,22,220
Codon 26 MnlI12,37,106,16,60,62 12,37,106,16,122
Codon 15 SfcI 293 202,91
Codon 17 BfaI24,114,155 24,114,72,83
Codon 19 MaeII 218,75 293
Codon 30 Bsp1286I167,126 167,83,43
IVS-1 nt2 Cac8I 293 250,43
IITLF62392-TLR62703Codon 41/42 TaqI 312 263,49

  • ↵1-150 The primers used were: TLF62028-5′ACCTCACCCTGTGGAGCCAC3′ (common C in Old et al 3); TLR62320-5′CTATTGGTCTCCTTAAACCTGTCTTGTAACCTTGCTA3′; TLF62392-5′TATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTT GGACCCAGAGGTC3′; TLR62703-5′ CCCCTTCCTAT GACATGAACTTAA 3′; modifications in nucleotide sequence are indicated by bold letters.

  • ↵1-151 Bold numbers indicate fragments of distinguishable sizes.