Article Text

PDF

Identification of a new TWIST mutation (7p21) with variable eyelid manifestations supports locus homogeneity of BPES at 3q22

Statistics from Altmetric.com

Editor—Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is an autosomal dominant disorder of eyelid development defined by small palpebral fissures, epicanthus inversus, and ptosis.1 2 BPES type I (OMIM 110100) is characterised by female infertility, whereas BPES type II (OMIM 601649) is transmitted by both females and males. Most cases of BPES types I and II map to chromosome 3q22-q23 (BPES1).3-7However, a second locus (BPES2) was reported in the chromosome 7p13-p21 region on the basis of patients presenting with eyelid anomalies carrying chromosomal abnormalities in the 7p21 region8-11 and the further linkage data of a large Indian family diagnosed initially with BPES type II.7 TheTWIST gene, mapped on chromosome 7p21, codes for a transcription factor with a bHLH domain.12 TWIST mutations13-18 have been reported in the heterozygous state in patients presenting with the Saethre-Chotzen syndrome (SCS, OMIM 101400). This disorder is a common autosomal dominant form of syndromic craniosynostosis defined by craniostenosis, minor limb and ear abnormalities, and frequent ptosis of the eyelids.19 In the present study, molecular genetic analysis at TWIST and subsequent clinical re-evaluation of the Indian family were used to investigate the possibility that prominent eyelid malformations may represent a clinical variant in the spectrum of phenotypes associated with SCS.

The four generation Indian family originates from the Bihar region in the western part of India. The members of the family were initially referred in 1995 because of palpebral anomalies.7 Clinical re-evaluation of the family took place at the Anandalok Eye Hospital in Calcutta in June 2000. Nineteen members of the family, including 17 affected persons, were examined in detail (photographs andx rays available on request for all affected members).

DNA samples, extracted from Guthrie cards, were available from 31 members of the Indian family.7 These samples were PCR amplified for TWIST and PCR products were subjected to single strand sequence conformation polymorphism (SSCP) and direct sequencing analyses. The primer pair that allowed detection of the mutations reported here was forward primer, VB56 (5′ - GAG GCGCCCCGCTCTTCTCCTCTG - 3′) and reverse primer TQ 53 (5′ - CGTCTGAAGAACGGCGCGAA - 3′). A specific migration pattern was observed after amplification of the DNA of all 16 members of the Indian family who were previously reported to have an abnormal clinical examination. In all cases, the abnormal SSCP pattern cosegregated with the previously reported haplotype of linked chromosome 7p markers7 (fig 1). Direct sequence analyses were performed on the PCR products of all 31 DNA samples. All 16 samples with an abnormal SSCP pattern showed the same heterozygous mutation, namely a C to T transition at position +82, changing a CAG codon to TAG, which is predicted to result in premature termination of the protein at codon 28 (28 C→T) positioned far upstream of the bHLH motif and probably within the recently reported histone acetyltransferase interaction domain.20 This nonsense TWISTmutation probably results in the absence of stable protein synthesis from the mutant allele and suggests that haploinsufficiency at the TWIST locus is responsible for the phenotype in this Indian family.

Figure 1

Abnormal SSCP pattern and sequence analysis showing the TWIST mutation (identification of patients was done according to Maw et al7). (A) Abnormal SSCP band (arrow) of affected patients (arrow heads) compared to unaffected members of the family. (B) Sequence analysis: antisense sequence of II.4, an unaffected member of the family, compared to IV.2, a patient carrying the mutation. All the patients with an abnormal SSCP band carried the 28 C→T mutation.

The phenotype of family members carrying the mutation showed very mild clinical features of SCS in some subjects without evidence of obvious craniostenosis but more pronounced eyelid manifestation compared to other subjects with all the clinical and radiographic evidence of craniostenosis as well as brachydactyly and external ear anomalies (fig2). Collectively, the phenotype of the affected members of this family was compatible with the diagnosis of SCS with variable expressivity and more pronounced eyelid manifestations in some of them.

Figure 2

Photographs of two members of the family carrying the mutation showing variable phenotypes. (A) Full face of patient II.1 showing bilateral ptosis and reduced palpebral aperture. (B) Profile of patient II.I. (C) Full face of patient IV.6 showing asymmetrical orbits and narrow forehead. (D) Profile of patient IV.6 with obvious exophthalmos.

Variable expressivity in SCS has been extensively underlined as a pitfall in the establishment of the diagnosis.19 21 In most cases, the details of the dysmorphic gestalt could not be correlated with the functional defects expected from theTWIST mutations detected. That the clinical features of some members of the Indian family were easily confused with BPES indicates that palpebral anomalies may be the main manifestation of haploinsufficiency at the TWIST locus in some SCS patients.

In conclusion, genetic and phenotypic assessment of the Indian family, previously reported as locus BPES2, now suggests that autosomal dominant BPES (types I and II) is probably a homogeneous disorder with a unique locus on chromosome 3q22-q23 (locusBPES1).

Acknowledgments

We are most grateful to RETINA France for supporting this project. We would like to thank Dr M Le Merrer, Dr J Kaplan, and Professor P Chambon for their continued support. We also thank S Vicaire and the oligonucleotide team from the IGBMC. R Quillet is recipient of a grant from le Ministere de l'Enseignement Superieur et de la Recherche. This work was supported by grants from l'Association de la Recherche sur le Cancer (ARC), from the Faculté de Médecine de Strasbourg, from the Centre National de la Recherche Scientifique, from the Institut National de la Santé et de la Recherche Médicale, and from Les Hôpitaux Universitaires de Strasbourg.

References

View Abstract

Request permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.