Article Text

PDF

Characterisation of six large deletions in TSC2 identified using long range PCR suggests diverse mechanisms including Alu mediated recombination

Statistics from Altmetric.com

Editor—Tuberous sclerosis complex (TSC) is an autosomal dominant familial tumour syndrome (OMIM 19110 and 191092,http://www.ncbi.nlm.nih.gov/omim/). It is characterised by the development of benign tumours (hamartomas), most frequently in the brain, skin, and kidneys. It is highly penetrant although with variable expression. In the majority of cases, there is significant neurological morbidity as seizures and mental retardation are common. Two causative genes for TSC have been identified, TSC1 andTSC2.1 2 Reports on mutation analysis in TSC show over 300 unique mutations with a varied spectrum. In cases where a mutation can be identified, approximately 80% have aTSC2 mutation and 20% have aTSC1 mutation. All reportedTSC1 mutations are small point mutations causing nonsense changes or splice site changes, or small insertions/deletions causing frameshift mutations. InTSC2, the majority (approximately 85%) are small mutations (point mutations causing splice, nonsense, or missense changes, or small insertion/deletions). The remaining 15% of reportedTSC2 mutations are large deletions (ranging in size from 1 kb to 1 Mb). Other large rearrangements (inversions, insertions, translocations) have also been reported, but these account for <1% of reported TSC2 mutations (http://zk.bwh.harvard.edu/ts).1-12

Because TSC is often a devastating disorder with a high frequency of sporadic cases, there is significant demand for genetic testing. Much progress has been made in detecting small mutations inTSC1 and TSC2using a variety of techniques, such as heteroduplex (HD) analysis, single stranded conformation analysis (SSCP), protein truncation test (PTT), denaturing gradient gel electrophoresis (DGGE), and most recently denaturing high performance liquid chromatography (DHPLC).3 5 6 8-11 13 14 Although it is important for improving the overall mutation detection rate in TSC patients, there has been less effort to develop new techniques for identifying large deletions in TSC2, which make up a small but significant percentage of TSC2mutations. Although screening for small mutations is the best initial strategy for detecting mutations in unknown cases, if a small mutation cannot be detected, the next approach should be screening for largeTSC2 deletions. Southern blotting is currently the standard approach but unfortunately it has the disadvantage of requiring substantial quantities of DNA. Cytogenetics and fluorescence in situ hybridisation (FISH) are also standard techniques for detecting large deletions, but require either a fresh blood sample or cultured lymphocytes, and have other limitations.

Long range PCR is an alternative method which has been used to identify large deletions and chromosome breakpoints in other disorders.15-18 The advantage of long range PCR is that it requires only small quantities of genomic DNA and standard PCR reagents. Also, if a mutation is detected by long range PCR, the sequence of the breakpoint fragments can then easily be determined for confirmation, in contrast to Southern blotting.

Here we describe a strategy for detecting large deletions inTSC2 using long range PCR and report six TSC cases with large deletions, all of which have been sequenced. These methods are important for both genetic testing purposes in TSC, and for the analysis of deletion junctions at the sequence level. This information on deletion junction sequences will help elucidate deletion mechanisms and might identify relative hotspots for these events. Furthermore, this long range PCR strategy is easily applied to other genes suspected of having large deletions.

DNA samples were collected from a series of 84 TSC patients who provided informed consent and met diagnostic criteria.19 A subset of 29 of these patients had no evidence of a small mutation inTSC1 or TSC2 by single exon amplification and mutational screening, and were screened in this study for large deletions in TSC2using long range PCR. DNA was extracted from white blood cells or EBV transformed lymphoblastoid cell lines using standard methods. An additional six samples suspected of having genomic rearrangements based on Southern blot abnormalities were also screened using long range PCR.

Long range PCR primers were designed using the primer design program of the Wisconsin Package (Genetics Computer Group), and chosen to be 22-33 bp in length with melting temperatures of 68-69°C. A series of 16 forward primers and 12 reverse primers were selected and spaced across the TSC2 genomic region (Genbank AC005600) at 2.8-9 kb intervals. Primer sequences and positions are shown in table 1. A series of 19 primer pairs (fig 1, table 2) were used in standard long range PCR. In addition, long nested multiplex PCR was performed using single forward primers and a series of reverse primers (fig 1 and fig 2C). All long PCR reactions were done in a volume of 25 μl using the LA PCR kit (TaKaRa). Each reaction contained 50-250 ng genomic DNA as template, 0.2 μmol/l of all primers, and 400 μmol/l dNTP. PCR cycling was done on a MJ Research PTC-100 thermal cycler for 32 cycles at 94°C for one minute, 98°C for 20 seconds, and 68°C for 15 minutes, followed by a final extension at 72°C for five minutes. Products were analysed on standard 0.8% agarose gels and stained with ethidium bromide. Agarose gels were run slowly (25-35 volts) for 24 hours at room temperature so that the bands of large amplicons (8-10 kb) were sharp. They were examined after electrophoresing for three to five hours and again after 24 hours. At three to five hours, the presence of all amplicons could be observed and the sizes of smaller amplicons (500 bp-2 kb) determined. The 24 hour time point allowed the detection of small (around 1 kb) size differences in the larger amplicons.

Table 1

TSC2 long PCR primers

Figure 1

Positions of overlapping amplicons and primers used in long nested PCR. At the top, the genomic organisation of TSC2 is illustrated with the positions of selected exons indicated. The dark lines numbered 1-19 represent the 1.7 kb to 11.6 kb amplicons generated using standard long range PCR. The primer pairs for each amplicon are listed in table 2. The rows of arrowheads at the bottom represent the positions of primer combinations used for the 14 long nested multiplex reactions (labelled a-n). Each row of primers represents a single PCR reaction in which a single forward primer (>) is combined with multiple reverse primers (<).

Table 2

TSC2 long PCR primer combinations

Figure 2

Examples of deletions in TSC2 detected using long range PCR. At the top is a diagram of the genomic organisation of selected exons in the TSC2 gene. It represents 79 586 base pairs of genomic sequence (Genbank AC005600). Below are the positions of selected primers which were useful for detecting four of the deletions described in this paper. Panel A shows a deletion in patient 1 detected with primers 25118F/5′UTR and 33053R/intron 6 which amplify exons 1-6. These primers should amplify a 7.9 kb band as illustrated by control samples in lanes 2 and 3, but in lane 1 the patient sample contains a 4.5 kb deletion between intron 2 and intron 5 so a smaller 3.4 kb band was amplified. In that patient there is only a very weak band at 7.9 kb representing the normal allele, reflecting the inferior amplification of the longer fragment in that sample. Panel B shows a deletion in patient 4 detected with primers 55586F/intron 25 and 65432R/3′UTR which amplify exons 26-41. These primers should amplify a 9.8 kb band as shown in control lanes 1, 2, 4, 5, and 6, but lane 3 illustrates a patient with a 1.4 kb deletion in which both a 9.8 kb band and an 8.4 kb band can be seen. Panel C shows two examples of deletions in TSC2 detected using the nested multiplex reaction. This agarose gel shows eight patient samples amplified using a single forward primer (25118F/5′UTR) and a collection of five reverse primers (42469R/intron 15, 49637R/exon 20, 54565R/intron 25, 60911R/intron 32, 65432R/3′UTR) in a long nested multiplex reaction. In this long nested multiplex reaction, an 800 bp amplicon is observed in lane 3 (patient 2) and a 6 kb amplicon in lane 4 (patient 3) as indicated by the arrows. The presence of any band in this reaction indicates that a deletion in TSC2 is present. Normally there is no amplification as shown in lanes 1-2 and 5-8. The faint bands which appear in lanes 1-2 and the smear in lanes 5-6 were interpreted as non-specific PCR artefact which is observed in some samples but easily distinguished from reproducible amplification of an aberrant band when a deletion is present. DNA size standards (lambda BSTEII digest from New England Biolabs) are shown in panel A lane 4, panel B lane 7, and panel C lane 9.

In cases where there was evidence for a large deletion, the aberrant PCR amplicon generated using long range PCR and containing the deletion was then purified using a Qiagen gel purification column following the manufacturer's protocol. The purified amplicon was sequenced directly or used as a template for amplifying individualTSC2 exons to determine the precise location of the deletion. Primer sequences for PCR amplification of individualTSC2 exons can be found athttp://zk.bwh.harvard.edu/projects/tsc/. PCR was performed using Amplitaq® Gold (Perkin Elmer); 20 μl reactions were used with 1 μl of gel purified PCR product as template, 1.0 μmol/l of each primer, 10 mmol/l of dNTPs, 0.2 μl of Amplitaq® gold polymerase (Perkin Elmer), and the manufacturer's recommended buffers. PCR cycling was carried out on an MJ Research PTC-100 thermal cycler using 95°C for 12 minutes, followed by 35 cycles of 94°C for 30 seconds, 55-60°C (depending on the exon) for 30 seconds for annealing, 72°C for 45 seconds for extension, and a final extension step at 72°C for four minutes.

The deletion junctions of all six cases were sequenced. The region of the junction was narrowed down by a combination of direct sequencing as well as results of short PCR amplification of individual exons. In some cases, amplification of the junctions was repeated using internal primers. Automated sequencing was done using an ABI 377 machine (Perkin Elmer) with Big Dye terminator chemistries (Perkin Elmer). Sequence traces were analysed using Sequencher (Gene Codes).

We have developed a PCR based assay for detecting large deletions inTSC2. Initially, we designed four primer pairs for amplifying all exons of TSC2 in fragments ranging from 7.6-9.8 kb with no overlap (amplicons 1-4 in fig1, table 2). In a pilot study, we analysed a subset of TSC patient samples not yet found to harbour small TSC2mutations and identified one large deletion (4.5 kb, patient 1). With these four primer pairs, any deletions spanning a primer position would be missed as only the normal allele would amplify. In order to increase the probability of finding all deletions, we designed additional primers for amplifying overlapping segments of theTSC2 gene. Primers were positioned 2.8-9 kb apart over the span of the TSC2 gene in both directions. As all primers had melting temperatures of 68-69°C and all PCR reactions were done using identical cycling conditions (table1), different combinations of primers could be used to yield overlapping amplicons of different sizes. After testing all primers for PCR, we expanded our assay to included the amplification of a total of 19 overlapping fragments ranging in size from 1.7-11.6 kb (fig 1, table2). The smaller sized amplicons (1.7-5.5 kb) were included because smaller deletions of 500 bp-1 kb would be more easily detected in smaller amplicons.

Because the standard PCR described above would limit the detection of deletions to those ranging in size from 500 bp to 10 kb, we predicted that larger deletions could be identified if each forward primer was combined with a reverse primer far enough away such that amplification would only occur in the presence of a large deletion. Because the extension time for PCR cycling was 15 minutes, we estimated that primers spaced >15 kb apart would not produce an amplicon unless there was a deletion present. Rather than performing up to 12 individual PCR reactions with each forward primer and each different reverse primer, we included multiple reverse primers in nested multiplex reactions with a single forward primer, as illustrated in fig 1. This significantly reduced the number of PCR reactions per sample, thereby improving the efficiency of the assay and reducing costs. We did a series of 14 nested multiplex reactions on all samples. In this series, a PCR amplification was performed with a single forward primer and a series of two to 12 reverse primers. All forward primers listed in table 1were used in a nested multiplex reaction except 60883F and 63753F. In each case, the closest reverse primer was positioned >15 kb away to ensure that a PCR product would amplify only if a deletion was present in the TSC2gene.

We tested this long PCR strategy on a subset of a collection of 84 TSC patient samples with unknown mutations which were being investigated for TSC1 andTSC2 mutations. In this collection, 29/84 patients did not have evidence of a small mutation inTSC1 or TSC2after analysis by DHPLC.13 20 Four of these samples (patients 1-4) were found to have large deletions using our long PCR assay (fig 2, table 3). In two cases, standard PCR detected a smaller than expected band. In patient 1, using primers 25118F/5′UTR and 33058R/intron 6 amplified a 3.4 kb band rather than the expected 7.9 kb band (fig 2A). In patient 4, primers 55568F/intron25 and 65432R/3′UTR amplified both the normal 9.8 kb band representing the normal allele as well as an 8.4 kb band (fig 2B). In the other two cases (patients 2 and 3), nested multiplex reactions using 25118F/5′UTR with five reverse primers (42469R/intron 15, 49637R/exon 20, 54565R/intron 25, 60911R/intron 32, 65432R/3′UTR) amplified aberrant products suggesting a deletion in TSC2 was present (fig 2C). In these cases, repeat standard PCR was performed with primers 25118F/5′UTR and 65432R/3′UTR which verified the result and determined the size and location of the deletion.

Table 3

Positions of six TSC2 deletions

To investigate further the usefulness of this strategy, we obtained six TSC samples from another lab (AV) which were suspected of having large deletions or other rearrangements based on Southern blotting results. One of these (patient 5) has been described previously21 22 and the others were not fully characterised. In this series, two deletions were identified and their sequences determined. In one case, primers 49327F/intron 19 and 54565R/intron 25 amplified both the expected 5.2 kb band as well as a smaller 3.9 kb band suggesting a 1.3 kb deletion (patient 5). In the other case, the nested multiplex reaction using primer 33093F/intron 6 and several reverse primers (49637R/exon 20, 54565R/intron 25, 60911R/intron 32, 65432R/3′UTR, 74454R/3′UTR and 78956R/3′UTR) showed an aberrant 6.4 kb band suggesting a deletion was present. Repeat standard PCR using primers 33093F/intron 6 and 49637R/exon 20 also resulted in a 6.4 kb amplicon consistent with a 10.1 kb deletion (patient 6). Of these six cases, one was suspected to have an insertion and another was subsequently found to have a translocation involving the TSC2 gene,23 neither of which were detected using long range PCR.

All six deletions were characterised at the sequence level. A combination of short PCR of intervening exons and sequencing was used to narrow down the location of each deletion junction. Sequences of all six deletion junctions are shown in fig 3. In two cases, the deletions occurred within homologous Alu repeats (patient 1 and patient 6). Although Alu mediated recombination has been described in disease causing rearrangements in other disorders, this has not been reported previously for TSC2. In another two cases, there was a 3 bp overlap at the site of the junction, GCA in patient 3 and GGT in patient 5. In patient 2, there was an 11 bp insertion at the junction and 10 of these base pairs (TGCCTTCAGA) are identical to sequence found a few base pairs away in the intron 40 arm of the junction. In the last case (patient 4), there was a 6 bp insertion (GTTTC) at the junction with no apparent homology to either end. These results suggest there are diverse mechanisms causing deletions in theTSC2 gene.

Figure 3

Sequences of TSC2 deletion junctions. Patient 1: deletion junction between Alu repetitive sequences within intron 2 and intron 5. There are 110 bp of highly homologous sequence (88%) between the open triangles. The join occurs within the underlined sequence. Sequence shown in grey is the adjacent homologous sequences which are deleted. The asterisks show the mismatched sequences on the left arm and the carets show the mismatched sequences on the right arm. Patient 2: deletion junction between intron 1 and intron 40. There is an 11 bp insertion at the junction, the 10 underlined bases (GTGCCTTCAGA) in the insertion are repeated in intron 40 near the junction (also underlined). Patient 3: there is a 3 bp overlap (GCA) at the site of this deletion junction between intron 1 and exon 33. Patient 4: there is a 6 bp insertion (GTTTTC) between the deletion connecting exon 37 with exon 39. This small insertion is not repeated near deletion junction site. Patient 5: there is a 3 bp overlap (GGT) at the site of this deletion junction between intron 19 and intron 20. Patient 6: deletion junction between Alu repetitive sequences within intron 9 and intron 15. There are 88 bp of highly homologous sequence (88%) near the junction between the open arrows. The join occurs within the underlined sequence. The asterisks show the mismatched sequences on the left arm and the carets show the mismatched sequences on the right arm.

We have developed a useful strategy using long range PCR to identify large deletions ranging in size from 1.3 kb to 39 kb in theTSC2 gene. Because of the known mutation spectrum in TSC,1-12 it is most appropriate to analyse new samples for small mutations in TSC2 andTSC1 before using this assay. We used our long range PCR assay for mutation analysis in a set of 29/84 samples not found to have small TSC2 orTSC1 mutations by DHPLC or HD analysis of amplified exons. Using the long PCR method, we detected large deletions in 4/84 or 4.8%. This compares with the wide range of reported frequencies for large deletions in the TSC2gene: 24 of 163 patients (15%) had large deletions when screened by several methods, but only 11 of 163 (7%) would be small enough to be detected by this long PCR method3; 0/140 patients screened by Southern blot analysis24; and two of 88 patients (2%) screened by Southern blot analysis.25 If these three large studies are combined, 13/391 patients (3.3%) were found to have deletions in the 500 bp to 79 kb range. Thus, we suspect that our method is capable of detecting most deletions that occur between the primers used here. Clearly, it would fail to detect deletions that extend beyond these primers, many of which have been described,1 as well as translocations, most large insertions, and more complex genomic rearrangements, which appear rare (<1%) in TSC2.3 23 Another class of deletions that would be missed by this strategy are those that are intermediate in size (50-500 bp), which would often be missed by both single exon amplification strategies and deletion scanning by long range PCR or Southern blot analysis. These have yet to be reported inTSC2.

In this report we provide the first identification ofTSC2 deletion junction sequences (fig 3). Our results suggest that several mechanisms of deletion occur in this gene. In two cases (patients 1 and 6) Alu mediated homologous recombination occurred. Such Alu and LINE mediated rearrangements are well known for many disease genes,26-32 but have not yet been reported for TSC2. In these two cases, homologous Alu repeats are present in the introns which are inappropriately joined. In patient 1, there are 110 bp of sequence with 88% homology in the region of the recombination. In patient 6, there are 74 bp of homologous sequence with 88% homology flanking the deletion site. Rudiger et al 33 described a 26 bp core sequence (5′ - CCTGTAATCCCAGCACTTTGGGAGGC - 3′) which was at or very close to the junction sites of several Alu mediated LDL receptor gene deletions. Although copies of this 26 bp sequence are found within the introns at these deletions, they are at some distance (>250 bp) from the junction sites so it is not clear whether they played a role in the recombination process. It is also notable that all four introns involved in the Alu mediated deletions inTSC2 contain poly T or poly A tracts or both flanking the Alu repeat, at distances less than 400 bp away. Flanking poly A/T tracts have been identified in Alu mediated deletions in the Fanconi A gene.34 35

The deletion junctions in the remaining four patients were diverse. There are two cases (patients 3 and 5) in which there is a 3 bp overlap at the junction. A similar 3 bp overlap has also been observed in an α globin mutation, but the mechanism for the illegitimate recombination is not well understood.28 In the last two cases (patients 2 and 4) there are small insertions at the junction. In patient 4, there is a 6 bp insertion (GTTTC) with no homology to either arm of the junction. It is interesting to note that this insertion contains GTT which is commonly found at topoisomerase I cleavage sites.36 In patient 2, the 10 bp of the 11 bp insertion between intron 1 and intron 40 are identical to a 10 bp (GTGCCTTCAGA) stretch in intron 40 close to the deletion site. In addition, the 11 bp insertion contains CTT which is another sequence commonly found at topoisomerase I cleavage sites.36 A small insertion at the site of a deletion has also been described in a 20.7 kb factor VIII gene deletion.16 Defining the deletion junctions of a larger number of TSC2 deletion cases may be helpful, but based upon present observations several mechanisms of deletions occur in TSC2 without a regional hot spot.

The major advantages of this long PCR approach are that it is simple, requires no special reagents or laboratory equipment, and can be performed on small quantities of genomic DNA, which is easily stored for long periods of time. Furthermore, the sequence of the deletion junction can be determined once an aberrant PCR amplicon is generated, to provide final confirmation that a mutation has been detected. Although we detected a deletion as small as 1.3 kb in this study, we suspect that deletions as small as 500 bp could be detected. The largest deletion detected here was 39 kb, but theoretically deletions as large as approximately 70 kb could be detected with the primers reported here. With effort in designing additional primers, it is possible that larger deletions could be identified using this method.

The disadvantages of this long PCR strategy is that it is not automated and to analyse each sample requires 33 individual PCR reactions. Although any false positive PCR results would quickly be eliminated after sequencing data were obtained, a false negative could go undetected. Because the PCR failure rate can be as high as 20-30%, it is important always to include positive controls in each PCR set. Another disadvantage is that although long PCR might detect some insertions, it would not detect translocations or inversions, none of which appear to be common in TSC2 but have been reported.3 23 It is likely that many insertions would not be detected because amplification of the shorter normal allele would be favoured during PCR. Although other new methods such as spectral karyotyping,37 dynamic molecular combing,38 or quantitative PCR27 39 may ultimately prove to be more powerful for detecting large deletions and other large rearrangements, they have been used on a limited number of genes and have not been tested in large numbers of samples with unknown mutations. Furthermore, these methods are not widely used and all require access to expensive, specialised equipment.

Although large deletions in the human genome are not as common as single nucleotide polymorphisms,40 41 they make a significant contribution to deleterious mutations and for some genes are the most frequent mutation type. In Duchenne muscular dystrophy, large deletions account for 65% of mutations.39 In the Fanconi anaemia group A gene, 40% of mutations identified in a set of 26 patients were large intragenic deletions.27 It has been reported that large deletions account for 36% of allBRCA1 mutations including two important founder mutations in a Dutch population of breast cancer families in which a BRCA1 mutation was identified.29 As it is generally difficult to assay for all possible deletions, it is quite likely that large deletions and other rearrangements may be under-reported and may account for a significant percentage of subjects with linkage to certain genes but in which no mutation has been identified. For instance, it has been suggested that large rearrangements may explain a substantial fraction of the 37% of breast/ovarian cancer families which show linkage to theBRCA1 gene but for whom no mutation has been identified.30 Undetected deletions may contribute to the 20-30% of TSC patients in which no TSC1 orTSC2 mutation can be identified,3 although there are several other reasons for failure of mutation identification in TSC.

Acknowledgments

We thank Joon Chung for assistance with sequencing and Edward Jung for technical assistance. We also thank the TSC patients and their families for contributing blood samples or financial support for this project. This work was supported by NIH grants CA71445 (SD), NS 31535 (DK), and the National Tuberous Sclerosis Association. Internet resources: <http://zk.bwh.harvard.edu/ts> <http://zk.bwh.harvard.edu/projects/tsc/> <http://www.ncbi.nlm.nih.gov/omim/>

References

View Abstract

Request permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.